ID: 1145156936

View in Genome Browser
Species Human (GRCh38)
Location 17:20550171-20550193
Sequence CACTGTCCCCATGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145156936_1145156949 3 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156949 17:20550197-20550219 GCTGTAGTTCTAGGGAAATGGGG No data
1145156936_1145156953 13 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156953 17:20550207-20550229 TAGGGAAATGGGGGAGGACAGGG No data
1145156936_1145156945 -6 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156945 17:20550188-20550210 ACAGTGAGGGCTGTAGTTCTAGG No data
1145156936_1145156957 22 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156957 17:20550216-20550238 GGGGGAGGACAGGGGCAGGTGGG No data
1145156936_1145156946 -5 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156946 17:20550189-20550211 CAGTGAGGGCTGTAGTTCTAGGG No data
1145156936_1145156956 21 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156956 17:20550215-20550237 TGGGGGAGGACAGGGGCAGGTGG No data
1145156936_1145156952 12 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156952 17:20550206-20550228 CTAGGGAAATGGGGGAGGACAGG No data
1145156936_1145156955 18 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156955 17:20550212-20550234 AAATGGGGGAGGACAGGGGCAGG No data
1145156936_1145156947 1 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156947 17:20550195-20550217 GGGCTGTAGTTCTAGGGAAATGG No data
1145156936_1145156950 4 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156950 17:20550198-20550220 CTGTAGTTCTAGGGAAATGGGGG No data
1145156936_1145156948 2 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156948 17:20550196-20550218 GGCTGTAGTTCTAGGGAAATGGG No data
1145156936_1145156954 14 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156954 17:20550208-20550230 AGGGAAATGGGGGAGGACAGGGG No data
1145156936_1145156951 7 Left 1145156936 17:20550171-20550193 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145156951 17:20550201-20550223 TAGTTCTAGGGAAATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145156936 Original CRISPR CACTGTCCCCATGGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr