ID: 1145158125

View in Genome Browser
Species Human (GRCh38)
Location 17:20556285-20556307
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145158125_1145158129 1 Left 1145158125 17:20556285-20556307 CCTACACTATGCGTATTATTTGA No data
Right 1145158129 17:20556309-20556331 GGTTGGCTGTGATTAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145158125 Original CRISPR TCAAATAATACGCATAGTGT AGG (reversed) Intergenic
No off target data available for this crispr