ID: 1145158453

View in Genome Browser
Species Human (GRCh38)
Location 17:20558171-20558193
Sequence CTTTATTCACAATAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145158453_1145158465 23 Left 1145158453 17:20558171-20558193 CCCCCCTCCTATTGTGAATAAAG No data
Right 1145158465 17:20558217-20558239 CCCTGTGTTCGCTTCTTGTCTGG No data
1145158453_1145158467 24 Left 1145158453 17:20558171-20558193 CCCCCCTCCTATTGTGAATAAAG No data
Right 1145158467 17:20558218-20558240 CCTGTGTTCGCTTCTTGTCTGGG No data
1145158453_1145158468 25 Left 1145158453 17:20558171-20558193 CCCCCCTCCTATTGTGAATAAAG No data
Right 1145158468 17:20558219-20558241 CTGTGTTCGCTTCTTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145158453 Original CRISPR CTTTATTCACAATAGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr