ID: 1145160508

View in Genome Browser
Species Human (GRCh38)
Location 17:20570948-20570970
Sequence ATTAGTGAAGGGCCATCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145160508_1145160513 9 Left 1145160508 17:20570948-20570970 CCGCAGGATGGCCCTTCACTAAT No data
Right 1145160513 17:20570980-20571002 GTGTATCCTTAGCTCAGGCTGGG No data
1145160508_1145160515 15 Left 1145160508 17:20570948-20570970 CCGCAGGATGGCCCTTCACTAAT No data
Right 1145160515 17:20570986-20571008 CCTTAGCTCAGGCTGGGAAACGG No data
1145160508_1145160512 8 Left 1145160508 17:20570948-20570970 CCGCAGGATGGCCCTTCACTAAT No data
Right 1145160512 17:20570979-20571001 TGTGTATCCTTAGCTCAGGCTGG No data
1145160508_1145160511 4 Left 1145160508 17:20570948-20570970 CCGCAGGATGGCCCTTCACTAAT No data
Right 1145160511 17:20570975-20570997 GACATGTGTATCCTTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145160508 Original CRISPR ATTAGTGAAGGGCCATCCTG CGG (reversed) Intergenic
No off target data available for this crispr