ID: 1145163245

View in Genome Browser
Species Human (GRCh38)
Location 17:20589573-20589595
Sequence GGAGCAGACGTCGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145163245_1145163247 -4 Left 1145163245 17:20589573-20589595 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1145163247 17:20589592-20589614 CTCCTCTGATTCCTTCAACGAGG No data
1145163245_1145163250 20 Left 1145163245 17:20589573-20589595 CCCGCGGCGGCGACGTCTGCTCC No data
Right 1145163250 17:20589616-20589638 CAACACTGCCTTCGCCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145163245 Original CRISPR GGAGCAGACGTCGCCGCCGC GGG (reversed) Intergenic
No off target data available for this crispr