ID: 1145175440

View in Genome Browser
Species Human (GRCh38)
Location 17:20697207-20697229
Sequence GTCACCAACACTACTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145175440_1145175442 29 Left 1145175440 17:20697207-20697229 CCTTCTCTAGTAGTGTTGGTGAC No data
Right 1145175442 17:20697259-20697281 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145175440 Original CRISPR GTCACCAACACTACTAGAGA AGG (reversed) Intergenic
No off target data available for this crispr