ID: 1145177115

View in Genome Browser
Species Human (GRCh38)
Location 17:20710455-20710477
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145177110_1145177115 10 Left 1145177110 17:20710422-20710444 CCTACATTTCATAATAGAAAACC No data
Right 1145177115 17:20710455-20710477 CAGTGTTAGCTGCTGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145177115 Original CRISPR CAGTGTTAGCTGCTGGAATA AGG Intergenic
No off target data available for this crispr