ID: 1145177807

View in Genome Browser
Species Human (GRCh38)
Location 17:20716904-20716926
Sequence CAGAGCCATCAAATTGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145177804_1145177807 23 Left 1145177804 17:20716858-20716880 CCTTTGTAATCAGTCACTTAACA No data
Right 1145177807 17:20716904-20716926 CAGAGCCATCAAATTGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145177807 Original CRISPR CAGAGCCATCAAATTGTACT GGG Intergenic
No off target data available for this crispr