ID: 1145179728

View in Genome Browser
Species Human (GRCh38)
Location 17:20736501-20736523
Sequence TTGATCTCCCTTTCATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145179728_1145179735 22 Left 1145179728 17:20736501-20736523 CCTGGAAATGAAAGGGAGATCAA No data
Right 1145179735 17:20736546-20736568 TGAAGAGACGGGCAGAGGTTTGG No data
1145179728_1145179734 17 Left 1145179728 17:20736501-20736523 CCTGGAAATGAAAGGGAGATCAA No data
Right 1145179734 17:20736541-20736563 GTGAGTGAAGAGACGGGCAGAGG No data
1145179728_1145179730 -5 Left 1145179728 17:20736501-20736523 CCTGGAAATGAAAGGGAGATCAA No data
Right 1145179730 17:20736519-20736541 ATCAATGTTCCTGGAGTGTGTGG No data
1145179728_1145179733 11 Left 1145179728 17:20736501-20736523 CCTGGAAATGAAAGGGAGATCAA No data
Right 1145179733 17:20736535-20736557 TGTGTGGTGAGTGAAGAGACGGG No data
1145179728_1145179732 10 Left 1145179728 17:20736501-20736523 CCTGGAAATGAAAGGGAGATCAA No data
Right 1145179732 17:20736534-20736556 GTGTGTGGTGAGTGAAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145179728 Original CRISPR TTGATCTCCCTTTCATTTCC AGG (reversed) Intergenic
No off target data available for this crispr