ID: 1145180489

View in Genome Browser
Species Human (GRCh38)
Location 17:20746055-20746077
Sequence CTGTAGAAATGATGGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145180484_1145180489 26 Left 1145180484 17:20746006-20746028 CCTCAGTGAAATTTGGAGAAATC No data
Right 1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG No data
1145180483_1145180489 27 Left 1145180483 17:20746005-20746027 CCCTCAGTGAAATTTGGAGAAAT No data
Right 1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145180489 Original CRISPR CTGTAGAAATGATGGGGAAG AGG Intergenic
No off target data available for this crispr