ID: 1145186293

View in Genome Browser
Species Human (GRCh38)
Location 17:20797321-20797343
Sequence TAGGCCCCTCAGCTCCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145186293_1145186303 8 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186303 17:20797352-20797374 TTTTTGGGGCGGTAGTCCTGGGG No data
1145186293_1145186302 7 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186302 17:20797351-20797373 CTTTTTGGGGCGGTAGTCCTGGG No data
1145186293_1145186296 -8 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186296 17:20797336-20797358 GGGGCCTAGGAAAGTCTTTTTGG No data
1145186293_1145186297 -7 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186297 17:20797337-20797359 GGGCCTAGGAAAGTCTTTTTGGG No data
1145186293_1145186301 6 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186301 17:20797350-20797372 TCTTTTTGGGGCGGTAGTCCTGG No data
1145186293_1145186298 -6 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186298 17:20797338-20797360 GGCCTAGGAAAGTCTTTTTGGGG No data
1145186293_1145186304 14 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186304 17:20797358-20797380 GGGCGGTAGTCCTGGGGAAATGG No data
1145186293_1145186300 -3 Left 1145186293 17:20797321-20797343 CCTCCTAGGAGCTGAGGGGCCTA No data
Right 1145186300 17:20797341-20797363 CTAGGAAAGTCTTTTTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145186293 Original CRISPR TAGGCCCCTCAGCTCCTAGG AGG (reversed) Intergenic