ID: 1145186523

View in Genome Browser
Species Human (GRCh38)
Location 17:20799331-20799353
Sequence TGTGGGGCATGAAACTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145186516_1145186523 25 Left 1145186516 17:20799283-20799305 CCATATGAAAACATGACAATTTA No data
Right 1145186523 17:20799331-20799353 TGTGGGGCATGAAACTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145186523 Original CRISPR TGTGGGGCATGAAACTTTTC TGG Intergenic
No off target data available for this crispr