ID: 1145188336

View in Genome Browser
Species Human (GRCh38)
Location 17:20815763-20815785
Sequence ATCAATTAGAAGTCAGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145188329_1145188336 28 Left 1145188329 17:20815712-20815734 CCTAATGTACTATCCCATTTACA No data
Right 1145188336 17:20815763-20815785 ATCAATTAGAAGTCAGGATATGG No data
1145188333_1145188336 -4 Left 1145188333 17:20815744-20815766 CCGCAGGCAAAACTAACCTATCA No data
Right 1145188336 17:20815763-20815785 ATCAATTAGAAGTCAGGATATGG No data
1145188330_1145188336 15 Left 1145188330 17:20815725-20815747 CCCATTTACATAAAGTTTACCGC No data
Right 1145188336 17:20815763-20815785 ATCAATTAGAAGTCAGGATATGG No data
1145188331_1145188336 14 Left 1145188331 17:20815726-20815748 CCATTTACATAAAGTTTACCGCA No data
Right 1145188336 17:20815763-20815785 ATCAATTAGAAGTCAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145188336 Original CRISPR ATCAATTAGAAGTCAGGATA TGG Intergenic
No off target data available for this crispr