ID: 1145190799

View in Genome Browser
Species Human (GRCh38)
Location 17:20841488-20841510
Sequence CTGCCAGGCGGCGTCGATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 5, 1: 7, 2: 0, 3: 3, 4: 61}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190799_1145190813 23 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190799_1145190809 8 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190809 17:20841519-20841541 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
1145190799_1145190810 9 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190810 17:20841520-20841542 ACCAGGTGAGGGCGACCCTGGGG 0: 5
1: 2
2: 2
3: 22
4: 159
1145190799_1145190812 10 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190812 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 2
2: 4
3: 19
4: 240
1145190799_1145190804 -3 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190804 17:20841508-20841530 CAGGCCCTGCGCACCAGGTGAGG 0: 11
1: 0
2: 4
3: 14
4: 228
1145190799_1145190815 24 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190815 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467
1145190799_1145190805 -2 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190805 17:20841509-20841531 AGGCCCTGCGCACCAGGTGAGGG 0: 11
1: 0
2: 1
3: 14
4: 167
1145190799_1145190803 -8 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190803 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
1145190799_1145190808 7 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190799 Original CRISPR CTGCCAGGCGGCGTCGATGT CGG (reversed) Intronic