ID: 1145190801

View in Genome Browser
Species Human (GRCh38)
Location 17:20841500-20841522
Sequence GGTGCGCAGGGCCTGCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 10, 1: 2, 2: 3, 3: 33, 4: 324}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190801_1145190819 27 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190819 17:20841550-20841572 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
1145190801_1145190818 26 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190801_1145190809 -4 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190809 17:20841519-20841541 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
1145190801_1145190817 25 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190817 17:20841548-20841570 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
1145190801_1145190812 -2 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190812 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 2
2: 4
3: 19
4: 240
1145190801_1145190808 -5 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
1145190801_1145190815 12 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190815 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467
1145190801_1145190813 11 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190801_1145190810 -3 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190810 17:20841520-20841542 ACCAGGTGAGGGCGACCCTGGGG 0: 5
1: 2
2: 2
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190801 Original CRISPR GGTGCGCAGGGCCTGCCAGG CGG (reversed) Intronic