ID: 1145190802

View in Genome Browser
Species Human (GRCh38)
Location 17:20841503-20841525
Sequence CCTGGTGCGCAGGGCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 11, 1: 0, 2: 2, 3: 39, 4: 362}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190802_1145190815 9 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190815 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467
1145190802_1145190809 -7 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190809 17:20841519-20841541 CACCAGGTGAGGGCGACCCTGGG 0: 5
1: 6
2: 2
3: 15
4: 119
1145190802_1145190818 23 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190802_1145190810 -6 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190810 17:20841520-20841542 ACCAGGTGAGGGCGACCCTGGGG 0: 5
1: 2
2: 2
3: 22
4: 159
1145190802_1145190819 24 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190819 17:20841550-20841572 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
1145190802_1145190817 22 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190817 17:20841548-20841570 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
1145190802_1145190821 30 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190821 17:20841556-20841578 GGCACACCCAAGAGGGGACCAGG 0: 4
1: 4
2: 2
3: 13
4: 152
1145190802_1145190813 8 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190802_1145190812 -5 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190812 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 2
2: 4
3: 19
4: 240
1145190802_1145190808 -8 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190802 Original CRISPR CCTGGTGCGCAGGGCCTGCC AGG (reversed) Intronic