ID: 1145190803

View in Genome Browser
Species Human (GRCh38)
Location 17:20841503-20841525
Sequence CCTGGCAGGCCCTGCGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 10, 1: 2, 2: 2, 3: 28, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190799_1145190803 -8 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190803 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
1145190793_1145190803 28 Left 1145190793 17:20841452-20841474 CCAGCTCGGGCAGGCCTTCCGAG 0: 3
1: 8
2: 0
3: 7
4: 80
Right 1145190803 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
1145190796_1145190803 10 Left 1145190796 17:20841470-20841492 CCGAGAGGAACCTCTATGCCGAC 0: 5
1: 1
2: 6
3: 9
4: 55
Right 1145190803 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
1145190797_1145190803 0 Left 1145190797 17:20841480-20841502 CCTCTATGCCGACATCGACGCCG 0: 5
1: 3
2: 4
3: 1
4: 8
Right 1145190803 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321
1145190795_1145190803 14 Left 1145190795 17:20841466-20841488 CCTTCCGAGAGGAACCTCTATGC 0: 5
1: 1
2: 6
3: 4
4: 68
Right 1145190803 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 10
1: 2
2: 2
3: 28
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190803 Original CRISPR CCTGGCAGGCCCTGCGCACC AGG Intronic