ID: 1145190805

View in Genome Browser
Species Human (GRCh38)
Location 17:20841509-20841531
Sequence AGGCCCTGCGCACCAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 11, 1: 0, 2: 1, 3: 14, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190795_1145190805 20 Left 1145190795 17:20841466-20841488 CCTTCCGAGAGGAACCTCTATGC 0: 5
1: 1
2: 6
3: 4
4: 68
Right 1145190805 17:20841509-20841531 AGGCCCTGCGCACCAGGTGAGGG 0: 11
1: 0
2: 1
3: 14
4: 167
1145190797_1145190805 6 Left 1145190797 17:20841480-20841502 CCTCTATGCCGACATCGACGCCG 0: 5
1: 3
2: 4
3: 1
4: 8
Right 1145190805 17:20841509-20841531 AGGCCCTGCGCACCAGGTGAGGG 0: 11
1: 0
2: 1
3: 14
4: 167
1145190796_1145190805 16 Left 1145190796 17:20841470-20841492 CCGAGAGGAACCTCTATGCCGAC 0: 5
1: 1
2: 6
3: 9
4: 55
Right 1145190805 17:20841509-20841531 AGGCCCTGCGCACCAGGTGAGGG 0: 11
1: 0
2: 1
3: 14
4: 167
1145190799_1145190805 -2 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190805 17:20841509-20841531 AGGCCCTGCGCACCAGGTGAGGG 0: 11
1: 0
2: 1
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190805 Original CRISPR AGGCCCTGCGCACCAGGTGA GGG Intronic