ID: 1145190805 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:20841509-20841531 |
Sequence | AGGCCCTGCGCACCAGGTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 193 | |||
Summary | {0: 11, 1: 0, 2: 1, 3: 14, 4: 167} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145190795_1145190805 | 20 | Left | 1145190795 | 17:20841466-20841488 | CCTTCCGAGAGGAACCTCTATGC | 0: 5 1: 1 2: 6 3: 4 4: 68 |
||
Right | 1145190805 | 17:20841509-20841531 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
||||
1145190797_1145190805 | 6 | Left | 1145190797 | 17:20841480-20841502 | CCTCTATGCCGACATCGACGCCG | 0: 5 1: 3 2: 4 3: 1 4: 8 |
||
Right | 1145190805 | 17:20841509-20841531 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
||||
1145190796_1145190805 | 16 | Left | 1145190796 | 17:20841470-20841492 | CCGAGAGGAACCTCTATGCCGAC | 0: 5 1: 1 2: 6 3: 9 4: 55 |
||
Right | 1145190805 | 17:20841509-20841531 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
||||
1145190799_1145190805 | -2 | Left | 1145190799 | 17:20841488-20841510 | CCGACATCGACGCCGCCTGGCAG | 0: 5 1: 7 2: 0 3: 3 4: 61 |
||
Right | 1145190805 | 17:20841509-20841531 | AGGCCCTGCGCACCAGGTGAGGG | 0: 11 1: 0 2: 1 3: 14 4: 167 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145190805 | Original CRISPR | AGGCCCTGCGCACCAGGTGA GGG | Intronic | ||