ID: 1145190807

View in Genome Browser
Species Human (GRCh38)
Location 17:20841513-20841535
Sequence GTCGCCCTCACCTGGTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 10, 1: 1, 2: 0, 3: 5, 4: 62}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190807_1145190813 -2 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190807_1145190821 20 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190821 17:20841556-20841578 GGCACACCCAAGAGGGGACCAGG 0: 4
1: 4
2: 2
3: 13
4: 152
1145190807_1145190817 12 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190817 17:20841548-20841570 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
1145190807_1145190818 13 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190807_1145190823 25 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248
1145190807_1145190822 24 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190822 17:20841560-20841582 CACCCAAGAGGGGACCAGGCCGG 0: 4
1: 6
2: 2
3: 16
4: 254
1145190807_1145190827 27 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190827 17:20841563-20841585 CCAAGAGGGGACCAGGCCGGGGG 0: 2
1: 8
2: 1
3: 13
4: 202
1145190807_1145190825 26 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224
1145190807_1145190819 14 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190819 17:20841550-20841572 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243
1145190807_1145190815 -1 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190815 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 13
3: 65
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190807 Original CRISPR GTCGCCCTCACCTGGTGCGC AGG (reversed) Intronic