ID: 1145190808

View in Genome Browser
Species Human (GRCh38)
Location 17:20841518-20841540
Sequence GCACCAGGTGAGGGCGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 10, 1: 1, 2: 0, 3: 23, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190799_1145190808 7 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
1145190801_1145190808 -5 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
1145190795_1145190808 29 Left 1145190795 17:20841466-20841488 CCTTCCGAGAGGAACCTCTATGC 0: 5
1: 1
2: 6
3: 4
4: 68
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
1145190802_1145190808 -8 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
1145190796_1145190808 25 Left 1145190796 17:20841470-20841492 CCGAGAGGAACCTCTATGCCGAC 0: 5
1: 1
2: 6
3: 9
4: 55
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185
1145190797_1145190808 15 Left 1145190797 17:20841480-20841502 CCTCTATGCCGACATCGACGCCG 0: 5
1: 3
2: 4
3: 1
4: 8
Right 1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG 0: 10
1: 1
2: 0
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190808 Original CRISPR GCACCAGGTGAGGGCGACCC TGG Intronic