ID: 1145190813

View in Genome Browser
Species Human (GRCh38)
Location 17:20841534-20841556
Sequence ACCCTGGGGGCAGCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 6, 1: 1, 2: 6, 3: 37, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190811_1145190813 -10 Left 1145190811 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190807_1145190813 -2 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190799_1145190813 23 Left 1145190799 17:20841488-20841510 CCGACATCGACGCCGCCTGGCAG 0: 5
1: 7
2: 0
3: 3
4: 61
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190806_1145190813 -1 Left 1145190806 17:20841512-20841534 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190801_1145190813 11 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367
1145190802_1145190813 8 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190813 17:20841534-20841556 ACCCTGGGGGCAGCTCAGCCTGG 0: 6
1: 1
2: 6
3: 37
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190813 Original CRISPR ACCCTGGGGGCAGCTCAGCC TGG Intronic