ID: 1145190814

View in Genome Browser
Species Human (GRCh38)
Location 17:20841535-20841557
Sequence CCCAGGCTGAGCTGCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 6, 1: 1, 2: 9, 3: 60, 4: 426}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190814_1145190834 16 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190834 17:20841574-20841596 CCAGGCCGGGGGCCGGGGGGCGG 0: 2
1: 5
2: 24
3: 185
4: 1580
1145190814_1145190825 4 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224
1145190814_1145190830 11 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190830 17:20841569-20841591 GGGGACCAGGCCGGGGGCCGGGG 0: 3
1: 8
2: 4
3: 105
4: 1030
1145190814_1145190835 17 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190835 17:20841575-20841597 CAGGCCGGGGGCCGGGGGGCGGG 0: 2
1: 5
2: 25
3: 176
4: 1561
1145190814_1145190822 2 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190822 17:20841560-20841582 CACCCAAGAGGGGACCAGGCCGG 0: 4
1: 6
2: 2
3: 16
4: 254
1145190814_1145190827 5 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190827 17:20841563-20841585 CCAAGAGGGGACCAGGCCGGGGG 0: 2
1: 8
2: 1
3: 13
4: 202
1145190814_1145190831 12 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190831 17:20841570-20841592 GGGACCAGGCCGGGGGCCGGGGG 0: 3
1: 8
2: 4
3: 79
4: 690
1145190814_1145190828 9 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190828 17:20841567-20841589 GAGGGGACCAGGCCGGGGGCCGG 0: 3
1: 4
2: 7
3: 113
4: 827
1145190814_1145190829 10 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190829 17:20841568-20841590 AGGGGACCAGGCCGGGGGCCGGG 0: 7
1: 4
2: 5
3: 69
4: 652
1145190814_1145190832 13 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190832 17:20841571-20841593 GGACCAGGCCGGGGGCCGGGGGG 0: 3
1: 5
2: 5
3: 69
4: 849
1145190814_1145190838 27 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG 0: 6
1: 0
2: 1
3: 14
4: 195
1145190814_1145190837 26 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190837 17:20841584-20841606 GGCCGGGGGGCGGGCTTCCCTGG 0: 6
1: 1
2: 1
3: 38
4: 378
1145190814_1145190817 -10 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190817 17:20841548-20841570 TCAGCCTGGGCACACCCAAGAGG 0: 6
1: 4
2: 2
3: 10
4: 198
1145190814_1145190823 3 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248
1145190814_1145190818 -9 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190814_1145190840 30 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190840 17:20841588-20841610 GGGGGGCGGGCTTCCCTGGGAGG 0: 6
1: 4
2: 4
3: 45
4: 344
1145190814_1145190821 -2 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190821 17:20841556-20841578 GGCACACCCAAGAGGGGACCAGG 0: 4
1: 4
2: 2
3: 13
4: 152
1145190814_1145190819 -8 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190819 17:20841550-20841572 AGCCTGGGCACACCCAAGAGGGG 0: 6
1: 4
2: 1
3: 14
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190814 Original CRISPR CCCAGGCTGAGCTGCCCCCA GGG (reversed) Intronic