ID: 1145190818

View in Genome Browser
Species Human (GRCh38)
Location 17:20841549-20841571
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 6, 1: 4, 2: 3, 3: 31, 4: 279}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190807_1145190818 13 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190811_1145190818 5 Left 1145190811 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190801_1145190818 26 Left 1145190801 17:20841500-20841522 CCGCCTGGCAGGCCCTGCGCACC 0: 10
1: 2
2: 3
3: 33
4: 324
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190802_1145190818 23 Left 1145190802 17:20841503-20841525 CCTGGCAGGCCCTGCGCACCAGG 0: 11
1: 0
2: 2
3: 39
4: 362
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190814_1145190818 -9 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190806_1145190818 14 Left 1145190806 17:20841512-20841534 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279
1145190816_1145190818 -10 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190818 17:20841549-20841571 CAGCCTGGGCACACCCAAGAGGG 0: 6
1: 4
2: 3
3: 31
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type