ID: 1145190823

View in Genome Browser
Species Human (GRCh38)
Location 17:20841561-20841583
Sequence ACCCAAGAGGGGACCAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 2, 1: 8, 2: 4, 3: 29, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190807_1145190823 25 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248
1145190816_1145190823 2 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248
1145190811_1145190823 17 Left 1145190811 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248
1145190814_1145190823 3 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248
1145190806_1145190823 26 Left 1145190806 17:20841512-20841534 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 1145190823 17:20841561-20841583 ACCCAAGAGGGGACCAGGCCGGG 0: 2
1: 8
2: 4
3: 29
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190823 Original CRISPR ACCCAAGAGGGGACCAGGCC GGG Intronic