ID: 1145190825

View in Genome Browser
Species Human (GRCh38)
Location 17:20841562-20841584
Sequence CCCAAGAGGGGACCAGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 2, 1: 9, 2: 2, 3: 23, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190806_1145190825 27 Left 1145190806 17:20841512-20841534 CCCTGCGCACCAGGTGAGGGCGA 0: 10
1: 1
2: 0
3: 6
4: 90
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224
1145190807_1145190825 26 Left 1145190807 17:20841513-20841535 CCTGCGCACCAGGTGAGGGCGAC 0: 10
1: 1
2: 0
3: 5
4: 62
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224
1145190814_1145190825 4 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224
1145190811_1145190825 18 Left 1145190811 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224
1145190816_1145190825 3 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190825 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 23
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190825 Original CRISPR CCCAAGAGGGGACCAGGCCG GGG Intronic