ID: 1145190828

View in Genome Browser
Species Human (GRCh38)
Location 17:20841567-20841589
Sequence GAGGGGACCAGGCCGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 954
Summary {0: 3, 1: 4, 2: 7, 3: 113, 4: 827}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190816_1145190828 8 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190828 17:20841567-20841589 GAGGGGACCAGGCCGGGGGCCGG 0: 3
1: 4
2: 7
3: 113
4: 827
1145190814_1145190828 9 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190828 17:20841567-20841589 GAGGGGACCAGGCCGGGGGCCGG 0: 3
1: 4
2: 7
3: 113
4: 827
1145190811_1145190828 23 Left 1145190811 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 1145190828 17:20841567-20841589 GAGGGGACCAGGCCGGGGGCCGG 0: 3
1: 4
2: 7
3: 113
4: 827
1145190820_1145190828 -8 Left 1145190820 17:20841552-20841574 CCTGGGCACACCCAAGAGGGGAC 0: 6
1: 4
2: 2
3: 13
4: 151
Right 1145190828 17:20841567-20841589 GAGGGGACCAGGCCGGGGGCCGG 0: 3
1: 4
2: 7
3: 113
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190828 Original CRISPR GAGGGGACCAGGCCGGGGGC CGG Intronic