ID: 1145190832

View in Genome Browser
Species Human (GRCh38)
Location 17:20841571-20841593
Sequence GGACCAGGCCGGGGGCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 3, 1: 5, 2: 5, 3: 69, 4: 849}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190811_1145190832 27 Left 1145190811 17:20841521-20841543 CCAGGTGAGGGCGACCCTGGGGG 0: 5
1: 3
2: 6
3: 24
4: 238
Right 1145190832 17:20841571-20841593 GGACCAGGCCGGGGGCCGGGGGG 0: 3
1: 5
2: 5
3: 69
4: 849
1145190816_1145190832 12 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190832 17:20841571-20841593 GGACCAGGCCGGGGGCCGGGGGG 0: 3
1: 5
2: 5
3: 69
4: 849
1145190820_1145190832 -4 Left 1145190820 17:20841552-20841574 CCTGGGCACACCCAAGAGGGGAC 0: 6
1: 4
2: 2
3: 13
4: 151
Right 1145190832 17:20841571-20841593 GGACCAGGCCGGGGGCCGGGGGG 0: 3
1: 5
2: 5
3: 69
4: 849
1145190814_1145190832 13 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190832 17:20841571-20841593 GGACCAGGCCGGGGGCCGGGGGG 0: 3
1: 5
2: 5
3: 69
4: 849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190832 Original CRISPR GGACCAGGCCGGGGGCCGGG GGG Intronic