ID: 1145190835

View in Genome Browser
Species Human (GRCh38)
Location 17:20841575-20841597
Sequence CAGGCCGGGGGCCGGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1769
Summary {0: 2, 1: 5, 2: 25, 3: 176, 4: 1561}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190814_1145190835 17 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190835 17:20841575-20841597 CAGGCCGGGGGCCGGGGGGCGGG 0: 2
1: 5
2: 25
3: 176
4: 1561
1145190824_1145190835 -10 Left 1145190824 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 25
4: 185
Right 1145190835 17:20841575-20841597 CAGGCCGGGGGCCGGGGGGCGGG 0: 2
1: 5
2: 25
3: 176
4: 1561
1145190820_1145190835 0 Left 1145190820 17:20841552-20841574 CCTGGGCACACCCAAGAGGGGAC 0: 6
1: 4
2: 2
3: 13
4: 151
Right 1145190835 17:20841575-20841597 CAGGCCGGGGGCCGGGGGGCGGG 0: 2
1: 5
2: 25
3: 176
4: 1561
1145190816_1145190835 16 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190835 17:20841575-20841597 CAGGCCGGGGGCCGGGGGGCGGG 0: 2
1: 5
2: 25
3: 176
4: 1561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145190835 Original CRISPR CAGGCCGGGGGCCGGGGGGC GGG Intronic