ID: 1145190838

View in Genome Browser
Species Human (GRCh38)
Location 17:20841585-20841607
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 6, 1: 0, 2: 1, 3: 14, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145190824_1145190838 0 Left 1145190824 17:20841562-20841584 CCCAAGAGGGGACCAGGCCGGGG 0: 2
1: 9
2: 2
3: 25
4: 185
Right 1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG 0: 6
1: 0
2: 1
3: 14
4: 195
1145190816_1145190838 26 Left 1145190816 17:20841536-20841558 CCTGGGGGCAGCTCAGCCTGGGC 0: 7
1: 5
2: 11
3: 70
4: 491
Right 1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG 0: 6
1: 0
2: 1
3: 14
4: 195
1145190820_1145190838 10 Left 1145190820 17:20841552-20841574 CCTGGGCACACCCAAGAGGGGAC 0: 6
1: 4
2: 2
3: 13
4: 151
Right 1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG 0: 6
1: 0
2: 1
3: 14
4: 195
1145190814_1145190838 27 Left 1145190814 17:20841535-20841557 CCCTGGGGGCAGCTCAGCCTGGG 0: 6
1: 1
2: 9
3: 60
4: 426
Right 1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG 0: 6
1: 0
2: 1
3: 14
4: 195
1145190826_1145190838 -1 Left 1145190826 17:20841563-20841585 CCAAGAGGGGACCAGGCCGGGGG 0: 6
1: 4
2: 0
3: 24
4: 245
Right 1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG 0: 6
1: 0
2: 1
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type