ID: 1145193340

View in Genome Browser
Species Human (GRCh38)
Location 17:20866921-20866943
Sequence TCCAGCTGGCCAGGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 7, 1: 4, 2: 7, 3: 28, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145193329_1145193340 24 Left 1145193329 17:20866874-20866896 CCTGGGGTGGGAGTGAGTGCCTT 0: 8
1: 1
2: 14
3: 79
4: 1342
Right 1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG 0: 7
1: 4
2: 7
3: 28
4: 219
1145193331_1145193340 5 Left 1145193331 17:20866893-20866915 CCTTCACTGAAACCGGCCCCTGG 0: 5
1: 6
2: 10
3: 27
4: 189
Right 1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG 0: 7
1: 4
2: 7
3: 28
4: 219
1145193333_1145193340 -7 Left 1145193333 17:20866905-20866927 CCGGCCCCTGGCCAAGTCCAGCT 0: 6
1: 2
2: 4
3: 49
4: 429
Right 1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG 0: 7
1: 4
2: 7
3: 28
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145193340 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG Intronic
900003980 1:32077-32099 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900023707 1:202596-202618 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900392805 1:2441062-2441084 TCCAGGTGCCCAGGAAGTGGAGG + Intronic
900564200 1:3324340-3324362 TCAAGATGGCCAGGACTGGCAGG - Intronic
900606213 1:3524720-3524742 TCCAGATGGCCATGAACTGCGGG - Intronic
901150494 1:7098066-7098088 TTCAGCTGGGCAGGATTGGCTGG + Intronic
904859233 1:33522311-33522333 TCCAGAGGGCCAGGAACAGCTGG - Intronic
905237716 1:36561582-36561604 TTCACGTGGCCAGGAAATGCTGG - Intergenic
906526730 1:46497912-46497934 CCTGGCTCGCCAGGAATTGCGGG + Intergenic
906694228 1:47813344-47813366 TCCAGGTGGCCAGGGATGGAAGG + Intronic
907424998 1:54373986-54374008 TCCTGCTGGACAGGAAAGGCAGG + Intronic
907515765 1:54992371-54992393 CCCAGCTGGCCAGGACATCCTGG + Intergenic
908251169 1:62267126-62267148 CCCAGCATGCCAGGAAATGCAGG - Intronic
909599502 1:77447143-77447165 TGGAGATAGCCAGGAATTGCTGG - Intronic
914422414 1:147541572-147541594 ACCAGGAGGCCAGGGATTGCGGG + Exonic
914720855 1:150287686-150287708 TCCAGCTGGCCCAGACTTGCAGG + Intergenic
916232561 1:162554828-162554850 TCCGGCTGGCCACGAACTCCTGG - Intergenic
916726693 1:167529864-167529886 GCCACCTGGCAAGGAACTGCAGG - Intronic
917484861 1:175446736-175446758 TCCAGCTGACCATGACTTACAGG - Intronic
917801718 1:178577344-178577366 TCAAGCTGGCCTTGAATTCCTGG + Intergenic
921011380 1:211145269-211145291 TCCAGATGGCAAGGAACTGAAGG - Intergenic
922193277 1:223338614-223338636 TCCAGCAGTCCAGGAGTAGCTGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1062818644 10:518097-518119 CCGAGCTGACCAGGACTTGCTGG - Intronic
1063417465 10:5885747-5885769 TCCAAATGGCCATGCATTGCTGG + Exonic
1063829945 10:9940975-9940997 TCAACCTGGCTAGGAATTTCAGG - Intergenic
1064085665 10:12344722-12344744 TCCAGCTAGCCTGGAAGTCCAGG - Intergenic
1064703625 10:18047880-18047902 TCCAGCTGGACATGAATTTTGGG - Intergenic
1066327484 10:34377715-34377737 CCCAGCTGGTCTTGAATTGCTGG - Intronic
1067283500 10:44890866-44890888 TCCACCAGGGCAGCAATTGCAGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069756960 10:70779390-70779412 TTCTGCTGGCTAGGACTTGCTGG + Intronic
1070155585 10:73832825-73832847 CCCAGCTGGCCTCGAATTCCTGG + Intronic
1071715528 10:88091586-88091608 GCCAGCTACCCAGGAAATGCAGG + Intergenic
1071996385 10:91153522-91153544 TCCAGCTGGCCAGGATGTTGGGG + Intergenic
1073733977 10:106325150-106325172 TCTAACTGGCCAAGAATTGTTGG - Intergenic
1075526513 10:123191492-123191514 TCCAGGTGGACAGGAATTTTGGG - Intergenic
1076796810 10:132802381-132802403 TGCACCTGGCCAGGAATGGGGGG + Intergenic
1077285352 11:1763099-1763121 CCCAGCTGGTCAGGCATGGCCGG + Intronic
1078636468 11:13054902-13054924 TCAATCTGTCCAGGAATAGCAGG - Intergenic
1080741382 11:35067571-35067593 TCTAGGTGGCCAGGAAATACAGG - Intergenic
1081106654 11:39078706-39078728 TGCAGCTGGCCAGCACCTGCTGG + Intergenic
1083773089 11:64879046-64879068 TCCAGCTGGCTCGGAATCCCCGG + Intronic
1084443105 11:69187218-69187240 TACAGCTGCCCAGGATCTGCGGG + Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1091377404 12:34128-34150 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1091660090 12:2376913-2376935 ACTAGCTGGCCAGGAATGGTAGG + Intronic
1091852009 12:3707058-3707080 CCCAGCTGGACAGGATTTCCTGG + Intronic
1092162740 12:6324817-6324839 TCCAGGTGCCCAGGAGTTGCTGG + Intronic
1094081790 12:26544819-26544841 TCCAGCTGGTTAGGCATTACAGG + Intronic
1094500670 12:31018265-31018287 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1096341504 12:50804565-50804587 CCCAGCTGCCCAGGAGTTGGAGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100958685 12:99938202-99938224 GCCATATGGCCAGGAACTGCAGG + Intronic
1102243675 12:111341712-111341734 TCCTGCTGGCCAGGAACTTTTGG + Intronic
1102376504 12:112426033-112426055 TCAAGCTGGCCAGTAATTTCAGG - Intronic
1104659923 12:130604045-130604067 TCCAGCAGGACAGGACATGCAGG + Intronic
1105274425 13:18906330-18906352 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1105299037 13:19116976-19116998 TGCAGCTGGCCACAAATTGCTGG + Intergenic
1107038269 13:35922879-35922901 TCCAGGTGCCCAGGGATGGCAGG - Intronic
1107818636 13:44266775-44266797 TCCAGCTGACCATGCATAGCAGG + Intergenic
1114051345 14:18921406-18921428 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1114111217 14:19480519-19480541 TGCAGCTGGCCAGAAATTGCTGG + Intergenic
1114187180 14:20411612-20411634 TCCCGCTGACCAGCAATTGTGGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118160820 14:63288334-63288356 CCCAGCTGTCCTGGAATTCCAGG + Intronic
1118899313 14:69973239-69973261 GCCAGCTTGCCAGGCATTTCTGG + Intronic
1119047661 14:71334446-71334468 AGAAGCTGCCCAGGAATTGCAGG - Intronic
1122133633 14:99620349-99620371 ACCTGCTGGACAGGAATGGCTGG + Intergenic
1123538306 15:21261509-21261531 TCCAGCTGACCAGGAATTGCTGG + Intergenic
1123765369 15:23472532-23472554 CCCACCTGGCCAGAAATTTCAGG - Intergenic
1124073688 15:26421212-26421234 ACCAGGTGGCCAGGAAGTGCTGG - Intergenic
1125280728 15:38040050-38040072 TCCATGTGGCAAGGAACTGCAGG - Intergenic
1128144040 15:65322474-65322496 TCCAGCTGGTCTCGAATTCCTGG + Intergenic
1128434263 15:67630026-67630048 TCAGGCTGGCCTGGAACTGCTGG - Intronic
1130152951 15:81324944-81324966 TCCAGCTGCCCTGGAGCTGCGGG + Intergenic
1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
1132677209 16:1125767-1125789 TCCAGCTGGCCAGGCTCTGAGGG + Intergenic
1137823899 16:51472726-51472748 TACTGCTTGCCAGGAGTTGCAGG - Intergenic
1138345607 16:56318290-56318312 TCCAGCTGGCGAAGAATTCTGGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1140831149 16:78752831-78752853 CCTAGCTGGCCAGGAATTCCAGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1142469215 17:153359-153381 GCCAGATGGACAGGAATTCCAGG - Intronic
1143017628 17:3899399-3899421 CCCACCTGGCCAGGACTAGCTGG - Intronic
1144829058 17:18121621-18121643 TCCCCCTGGCCAGGAGGTGCAGG + Exonic
1144838465 17:18171044-18171066 TCCAGCTGGTCAGGATGGGCTGG + Intronic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1148463929 17:47853331-47853353 CCCAACTGGCCAGGATTTGTAGG - Intronic
1150025382 17:61668780-61668802 TCCAGCTGGTCTGGAACTACTGG + Intergenic
1151017880 17:70577758-70577780 TCCAGCTGAACAGGAGTTGCTGG + Intergenic
1152638517 17:81439945-81439967 TCCTGCAGGCGAGGAAGTGCAGG - Intronic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1154302506 18:13206836-13206858 TCCAGCTGCCCAGGAATTCCAGG - Intergenic
1154466114 18:14643585-14643607 TCCAGCTGGCCAGGAACTGCTGG - Intergenic
1155028902 18:21967143-21967165 TCCAGCTGGCCTTGAAATCCTGG - Intergenic
1155082947 18:22428779-22428801 TCCAGCTGGCCAGGCAGTGTGGG + Intergenic
1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG + Intronic
1160512247 18:79459148-79459170 CCCACCTGCGCAGGAATTGCAGG + Intronic
1160635732 19:73686-73708 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1161975247 19:7604904-7604926 TCCAGCTGGCCTGGTATTGGGGG + Intronic
1162659067 19:12155557-12155579 TTCAGCGAGACAGGAATTGCAGG - Intronic
1162941296 19:14011164-14011186 TCCAGTCTGCCTGGAATTGCCGG + Intergenic
1163634388 19:18431511-18431533 GCCAGCTGGCCGGGCTTTGCTGG + Intronic
1164678193 19:30117222-30117244 TCCCGCTGGCCATTAATTCCGGG + Intergenic
1164990868 19:32682536-32682558 CGCAGCTGGCCAGGCCTTGCAGG - Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166903010 19:46080899-46080921 TCCACCTGGACAGGAAGTGATGG - Intergenic
925405318 2:3602213-3602235 GCCAGCTGGCTTGGAATTGTGGG + Intronic
926128850 2:10287864-10287886 GCCACCTGGCCAGGAACTGCGGG - Intergenic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
933899751 2:86840977-86840999 TTGAGCTGGCCAGGAAAAGCAGG + Intronic
934853074 2:97713424-97713446 TGCAGCTGGGCAGGCAGTGCTGG + Intergenic
936380704 2:111983370-111983392 TCCAAAAGGCCATGAATTGCTGG - Intronic
936525265 2:113236910-113236932 ACCAGCTGGCCTTGAATTCCAGG - Intronic
936562109 2:113549060-113549082 TCCAGTTGGCCATGAAAAGCTGG + Intergenic
936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
936987130 2:118322086-118322108 TCTAGCTGGCCAGAAGTTGGGGG - Intergenic
938287115 2:130128053-130128075 TGCAACTGGCCAGAAATTGCTGG + Intronic
938312529 2:130302305-130302327 TCCTGCTGGACAGAAATTGCTGG - Intergenic
938428478 2:131210817-131210839 TGCAACTGGCCAGAAATTGCTGG - Intronic
938469380 2:131544835-131544857 TGCAACTGGCCAGAAATTGCTGG - Intergenic
938768876 2:134482925-134482947 GCCAGCCGGCCAGAAAATGCCGG - Intronic
940677642 2:156744592-156744614 TCCATCCTGCCAAGAATTGCAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942858571 2:180582358-180582380 TCCAGGTGGACAGGTATTCCAGG + Intergenic
944017300 2:195057422-195057444 TACAGCTGTCTGGGAATTGCAGG - Intergenic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1170736981 20:19021196-19021218 GGCAGCTGGCCAGGGACTGCAGG - Intergenic
1171561901 20:26134415-26134437 TCCAGCTGGCCAACAATTGCTGG + Intergenic
1172706777 20:36887847-36887869 TCCACCAGCCCAGGAATTGCAGG + Intronic
1173236414 20:41249968-41249990 TCCAGCTGGCTTGGTATTGTCGG - Intronic
1175327653 20:58140905-58140927 TCCAGGTGGACAGGAGTTGGGGG + Intergenic
1176649410 21:9531219-9531241 TACACCTGGCCAGGAATTGCTGG - Intergenic
1176808471 21:13515011-13515033 TCCAGCTGGCCAGGAACTGCTGG + Intergenic
1179300007 21:40099728-40099750 GCCACCTGGGCAGGACTTGCTGG + Intronic
1179346272 21:40560378-40560400 TAGAGCTGGCCAGGAATTTCCGG - Intronic
1180469818 22:15643781-15643803 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1180589749 22:16927075-16927097 TCCAGCTGGCCAGGAAAAATTGG + Intergenic
1181161160 22:20960691-20960713 TCCAGCTTGCCATGAAGTTCTGG - Intergenic
1181641210 22:24200008-24200030 TCAGGCTGGTCAGGAACTGCTGG + Intergenic
1181677492 22:24465674-24465696 TCCATCTGGCAAGGTATGGCAGG + Intergenic
1182254775 22:29030676-29030698 TCCAGCGGGCCGGGACTTTCGGG - Intronic
1183626436 22:39005611-39005633 TCCATCTGCCCTGGAATTGGTGG - Intergenic
1184462141 22:44645144-44645166 TCCAGGTGGCCAGGAATTTTTGG + Intergenic
1184587027 22:45454812-45454834 TCCAGGTGGCCAGCAATGGCTGG - Intergenic
1184683428 22:46085221-46085243 GCCAGCTGGCCAGGCCTTCCCGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
949881048 3:8661042-8661064 CCCAGCTGGCCATGCATTTCTGG + Intronic
950140022 3:10609006-10609028 TCAAGGTGGCCCGGAATTCCGGG - Intronic
952345316 3:32478427-32478449 CCCAGCTGGTCTTGAATTGCTGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953286268 3:41612786-41612808 TTCTGATGGGCAGGAATTGCAGG - Intronic
953532110 3:43748252-43748274 GCCTGATGGCCAGGAATTCCTGG + Intergenic
955467790 3:59254487-59254509 TTCAGATGGCCAGGACTTCCAGG + Intergenic
955749891 3:62177052-62177074 CCAAGCTGGTCAGGAACTGCTGG - Intronic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
957074055 3:75587830-75587852 TCCAGCTGGCAGGGAAGCGCCGG - Intergenic
957653230 3:83035732-83035754 TGCAGCTGCCCAGCCATTGCTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962855719 3:139343032-139343054 TCCAGCTATCCAGGATGTGCAGG - Intronic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
964802260 3:160568934-160568956 TCAAGCTGGCCTGGAAATGGAGG + Intergenic
965075403 3:163968692-163968714 TGCAGCCAGGCAGGAATTGCGGG - Intergenic
968605330 4:1532604-1532626 TCCAGCCTGCCAGGAAATCCAGG + Intergenic
969663848 4:8545633-8545655 CCCAGGTGGCCAGGACTTGCTGG + Intergenic
970205848 4:13654728-13654750 TGGAGCCGGCCTGGAATTGCTGG - Intergenic
972023874 4:34352200-34352222 TCCAGATGGACATGAATTGGGGG + Intergenic
973955178 4:56056539-56056561 CCCAGCTGGTCTGGAATTCCTGG - Intergenic
975792606 4:77970859-77970881 TCCAGATGTTCAGGAATAGCTGG + Intergenic
977995835 4:103496722-103496744 TTCAGCTGGCCTGGACTTCCAGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982455832 4:155608620-155608642 TCCACCTGGCAAGGAACTGTGGG + Intergenic
984496312 4:180502410-180502432 TCAAGCTAGGCAGGAATTACAGG + Intergenic
985586997 5:745654-745676 TCCAGATGCCCTGGGATTGCTGG + Intronic
985961533 5:3306640-3306662 TGCAGATGCCCAGGAACTGCGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988519296 5:31931513-31931535 TGCAGCTGGGCAGGAGTTGAGGG + Intronic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
991222103 5:64228302-64228324 TCCAGCTGGCCTTGAACTCCTGG - Intronic
992743951 5:79801062-79801084 TCCATCTTGCCAGCAACTGCTGG - Intergenic
993455863 5:88126284-88126306 TCCACCTGGCCAGGAGTAGATGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995261786 5:110112842-110112864 ACCACATGGCCAGGAACTGCAGG - Intergenic
996009898 5:118470562-118470584 ACCAGCTGGCCAGTAATTTTAGG - Intergenic
998591622 5:143485191-143485213 TCCGTCTGGCCAGGGCTTGCTGG + Intergenic
998733474 5:145107722-145107744 TCCAGATGGACATGAATTTCTGG + Intergenic
998989949 5:147804558-147804580 TGCAGCTGAGCAGGAAATGCAGG + Intergenic
999535203 5:152508847-152508869 TCCAGGTGCTCAGGAATTACTGG + Intergenic
1001755446 5:174165100-174165122 TCCAGCTTGCCAGGGACTGAGGG + Intronic
1004502500 6:16221644-16221666 CCCAGCTGGTCACGAACTGCTGG + Intergenic
1006294178 6:33162561-33162583 CCCAGCTGGACAGGGCTTGCAGG + Intergenic
1006719354 6:36140051-36140073 TCCAGGTGGACATGAATTCCAGG + Exonic
1007600980 6:43081068-43081090 TCCAGCTGGACTGGAATGGAGGG - Intronic
1011252284 6:85384589-85384611 TCCAGCAGGCCAAGAGTTACAGG + Intergenic
1014102328 6:117525358-117525380 ACCAGCTGGGCAGAATTTGCTGG - Exonic
1014102694 6:117529371-117529393 ACCAGCTGGGCAGAATTTGCTGG - Intronic
1018040867 6:159921033-159921055 TCCAGGTGGACAGGAATTTTGGG - Intergenic
1018186311 6:161267819-161267841 TCAAGCTGGCCTTGAATTCCTGG - Intronic
1018785166 6:167102613-167102635 GCCTGCTGGCCTGGAAGTGCTGG - Intergenic
1023362518 7:39431120-39431142 TGCTGCGGGCCAGGCATTGCGGG + Intronic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1025820570 7:64959140-64959162 TTCACCTGGCCAGAATTTGCAGG + Intergenic
1026454282 7:70557252-70557274 CCCTGCTGGCTAGGATTTGCAGG + Intronic
1027596858 7:80184734-80184756 TCCACCTGACCAGGAATGTCAGG - Intronic
1030364660 7:108631525-108631547 TCCATTTGTCCAGGAAATGCTGG - Intergenic
1031337493 7:120554242-120554264 TGAAACTGGCCAGGAATAGCAGG - Intronic
1032147273 7:129395470-129395492 TCCAGCTCTCCAGGAAGGGCAGG - Intronic
1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG + Intronic
1034560615 7:151877290-151877312 TCCAGCGGGCCAAGAAGGGCAGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035680592 8:1484630-1484652 ACAAGCTGGACAGGAATTTCTGG + Intergenic
1036628093 8:10488704-10488726 TCCAGCTTGCCAGGGATTGTAGG - Intergenic
1039550175 8:38437669-38437691 TACAGCTGGCCAGGAACAGAAGG + Intronic
1043731631 8:83691176-83691198 TACTGCTGACCAGGAATTGTTGG + Intergenic
1044113833 8:88309531-88309553 TCCATCTGCCCAAGAGTTGCAGG - Intronic
1044530222 8:93299298-93299320 TCCAGGTGGGCAGGGATTTCTGG - Intergenic
1044895126 8:96883605-96883627 TCTAGCTGGCCTGGAACCGCAGG + Intronic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1046841822 8:118867108-118867130 TCCAACTGGGGAGGAATTCCTGG + Intergenic
1048349948 8:133608169-133608191 TCCTCCCGACCAGGAATTGCTGG + Intergenic
1048941758 8:139406014-139406036 ACCACCTGGGAAGGAATTGCTGG + Intergenic
1049211382 8:141387951-141387973 CCCAGCTGGCCAGGCCATGCAGG - Intergenic
1049384353 8:142333720-142333742 TGCAGGGGGCCAGGACTTGCTGG - Intronic
1049886674 9:31859-31881 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1049890569 9:66267-66289 TCCAGTTGGCCATGAAAAGCTGG - Intergenic
1051344288 9:16138634-16138656 TCCTGCTACCCAGGATTTGCAGG + Intergenic
1052206150 9:25843203-25843225 TCCATGTTGCCAGGAATGGCAGG - Intergenic
1052907823 9:33852341-33852363 TCTAGCTGGCCCGGAGTTACAGG + Intronic
1053732035 9:41067450-41067472 TCCAGTTGGCCATGAAAAGCTGG - Intergenic
1054696421 9:68364267-68364289 TCCAGTTGGCCATGAAAAGCTGG + Intronic
1056587421 9:87937861-87937883 TCCACCCGGCCAGGAATTACTGG + Intergenic
1056609455 9:88115081-88115103 TCCACCCGGCCAGGAATTACTGG - Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1059031458 9:110702146-110702168 TCCAACTAGCCCGGAAATGCTGG + Intronic
1059408721 9:114118654-114118676 TCCAGCAGGCCAGCCATTGAAGG - Intergenic
1060779480 9:126400927-126400949 TCCAGCTGGCTAGGATTTTCGGG + Intronic
1060974029 9:127754526-127754548 CCCAGCTGGCCGGGCAGTGCAGG - Intronic
1061059450 9:128243315-128243337 TCCAGCTGGCCAAGGAGTGGGGG + Intronic
1061329934 9:129885945-129885967 TCCAGCGGGTCAGGAAATACCGG - Intergenic
1061452969 9:130678534-130678556 CCCACCTGACCAGGAACTGCTGG + Exonic
1061875298 9:133540547-133540569 TTCAGCGGGGCAGGAAATGCCGG - Intronic
1062330845 9:136044304-136044326 TCCAGGTGGCCTCGAATTCCTGG - Intronic
1062582832 9:137236028-137236050 TCCCGCTGGCCAGGCACTTCGGG + Exonic
1203627151 Un_KI270750v1:34767-34789 TACACCTGGCCAGGAATTGCTGG - Intergenic
1186178486 X:6949959-6949981 TCCACATGGCCAGGAATTGAGGG - Intergenic
1186767218 X:12782941-12782963 TCCACCTCGCCAAGAATTGTTGG - Intergenic
1187710176 X:22045446-22045468 TCCAGCTGCCATGCAATTGCTGG - Intronic
1189611372 X:42739818-42739840 TCCATGTGGCAAGGAATTGAGGG - Intergenic
1194169764 X:90566554-90566576 TCCATCTGACCAGGAATATCAGG - Intergenic
1195868207 X:109456526-109456548 TTCAGCTGGCCAGGCTGTGCTGG + Intronic
1197146880 X:123181714-123181736 TACAGCTGGCCAAGCATGGCTGG + Intergenic
1197763532 X:130044329-130044351 TCCAGCTGGGCAGAAAATGAAGG + Intronic
1199664560 X:150086370-150086392 TCCAGCTCCCCAGGAAGTGATGG - Intergenic
1200137937 X:153883930-153883952 TGCACCTGGCCAGGACTGGCAGG - Intronic
1200516005 Y:4144327-4144349 TCCATCTGACCAGGAATATCAGG - Intergenic
1201552180 Y:15229231-15229253 ACCTGCTGGCCAGGGATTGAAGG - Intergenic