ID: 1145194391

View in Genome Browser
Species Human (GRCh38)
Location 17:20876504-20876526
Sequence TAGAAGGGCTGGAGGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 4, 1: 1, 2: 4, 3: 39, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145194385_1145194391 2 Left 1145194385 17:20876479-20876501 CCTCATGGATGGTATGAGTGTCT 0: 1
1: 4
2: 6
3: 81
4: 511
Right 1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG 0: 4
1: 1
2: 4
3: 39
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145194391 Original CRISPR TAGAAGGGCTGGAGGGAATT AGG Intronic
900489994 1:2943142-2943164 TAGATGGGCTGGAGAGGATGCGG - Intergenic
900958230 1:5901719-5901741 TAAAATGACTGGATGGAATTTGG + Intronic
901404146 1:9034688-9034710 TAGAAGGGAGGTAAGGAATTTGG - Intergenic
903945298 1:26959256-26959278 TTCAATGGCTGGAGGGAAGTGGG - Intronic
903964025 1:27074788-27074810 AAGAAAGGCTGGAAGGACTTGGG - Intergenic
903974498 1:27140422-27140444 TATATGGACTGGAGGGCATTGGG - Intronic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904677322 1:32206315-32206337 GAGAAGGGAAGGAGGGACTTGGG + Intronic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
906177628 1:43789187-43789209 TAGAAAGGATGGATGGAAATGGG + Intronic
908647116 1:66290190-66290212 TAGAAGGGGTGAAGGGCAGTGGG + Intronic
909457315 1:75864915-75864937 AAGAGAGGCTGGAGGGTATTAGG + Intronic
909476092 1:76082351-76082373 CAGAATGGCTGGAGGCAAATGGG - Intronic
910397423 1:86806557-86806579 TTGAAGGACTAAAGGGAATTAGG - Intergenic
911031174 1:93489928-93489950 CAGAAGTGCTGGAGGAACTTTGG + Intronic
911596553 1:99804660-99804682 TTGAAGGACAGGAAGGAATTGGG - Intergenic
912112897 1:106364789-106364811 TAGAAGTACAGCAGGGAATTTGG + Intergenic
912675233 1:111674068-111674090 TAGAAAAGCTGGAGGCATTTGGG + Intronic
913405363 1:118484977-118484999 TCTAAGTGCTGGATGGAATTGGG + Intergenic
913492815 1:119397474-119397496 TAAAAGGGCTTGAGGGAACTAGG - Intergenic
915493525 1:156265458-156265480 CAGAAGCCCTGGAGGGACTTGGG + Intronic
916605676 1:166340073-166340095 TAGAAGAGCAGGAGGGTATAAGG - Intergenic
917644619 1:177017992-177018014 TAGAAGCGGTTGAGGGCATTTGG - Intronic
918334227 1:183491956-183491978 CGAAAGGGCTGGAGAGAATTAGG - Intronic
921065974 1:211622056-211622078 TAGGAAGGCTGCAGAGAATTCGG + Intergenic
921675974 1:217976826-217976848 TGGAAGGGCTGGTAGGAGTTTGG + Intergenic
922789474 1:228303263-228303285 CAGGAAGGCTGGAGGGACTTGGG - Intronic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
924692858 1:246368422-246368444 TCCCAGGGCTGGGGGGAATTTGG - Intronic
1063938958 10:11107842-11107864 TAGAAGGGATGGGGAGAAATAGG - Intronic
1064415013 10:15141538-15141560 CAGAAGTCCTGGAGGGTATTTGG - Exonic
1064931196 10:20629383-20629405 TAGAAGGCCTGGACAAAATTAGG + Intergenic
1065482984 10:26213352-26213374 AAGAAGGCCTGGAGGGCACTTGG - Intergenic
1065724251 10:28654804-28654826 CACAAGGGATGGAGAGAATTGGG - Intergenic
1067349323 10:45461605-45461627 TGGAAAGTCTGGAGGGCATTTGG + Intronic
1067687145 10:48472632-48472654 CAGATGGGCTGGAGGGAGTGAGG - Intronic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1068381066 10:56254732-56254754 TAGGAGGGATGCAGGGAAATAGG - Intergenic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069132397 10:64722677-64722699 TAGAGGGGCTGTGGGGATTTGGG + Intergenic
1069813473 10:71179191-71179213 TAGCAGGGGTGGAGGGAAAGAGG - Intergenic
1070182805 10:74030711-74030733 TAGAAGGTCTGGCAGCAATTTGG - Intronic
1070604868 10:77891656-77891678 TAGCGGGGTTGGAGGGAATGTGG - Intronic
1071522642 10:86340699-86340721 TAGAAGGGGAGGAGGGAAGAAGG + Intronic
1071583480 10:86795646-86795668 TAGTAGGGAGGGAGGGAATTAGG + Intronic
1072951838 10:99854098-99854120 TAGAGGGGCAGGAGGAACTTTGG + Intergenic
1075742658 10:124705292-124705314 TAGAGGGGCAGGAGGGAAGGCGG + Intronic
1076717760 10:132375015-132375037 TAGAAAGGCTGGCAGGACTTAGG - Intronic
1077503151 11:2918247-2918269 TAGAGGGGCTGGAAGGAGGTGGG - Intronic
1083346733 11:61998724-61998746 TAAAAGTGCTGGAGGGAAGTGGG - Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084860386 11:72014251-72014273 TAAAAGAGCTGGAGGAACTTCGG - Exonic
1087458965 11:98422404-98422426 TAGAAGGACTAAAGAGAATTAGG - Intergenic
1087583499 11:100089899-100089921 TAGAGGGGAGGGAGAGAATTGGG + Intronic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1088510254 11:110566324-110566346 GAGAAGGGTTGCAGGGAAGTGGG + Intergenic
1088787027 11:113191232-113191254 GAGCAGGGTTGGAGGGAATTCGG + Intronic
1088843242 11:113644203-113644225 GAGAAGGGCAGGCGGGAATCAGG - Intergenic
1089433084 11:118438001-118438023 GAGAAGGGCGGGAGGGAGCTCGG - Intronic
1089835410 11:121366023-121366045 GAGAAGGGCAGGAGGTGATTTGG - Intergenic
1090362204 11:126181565-126181587 TCCTAGGGCTGGAGAGAATTGGG + Intergenic
1092931825 12:13322806-13322828 TTGAAGGGCCGGAGAGAATATGG + Intergenic
1094382374 12:29856586-29856608 TAGAAGAGCTTGAGAAAATTGGG - Intergenic
1094558620 12:31528195-31528217 TAGACCGTCTGGAGGGAGTTCGG - Intronic
1095634015 12:44409996-44410018 TAGAAAGGCTGGAGGAAACTGGG - Intergenic
1096048180 12:48582764-48582786 TGAAAGGGGTGGAGGGAATCTGG - Intergenic
1096571882 12:52528142-52528164 AAGAAGGGCTGGAGGAAATCAGG - Intergenic
1097179372 12:57162552-57162574 TGGAAGGGGTGGTGGGACTTAGG + Intronic
1097955391 12:65480315-65480337 TAAAAGGGTTGGAGGGAACTAGG - Intronic
1100452713 12:94722783-94722805 GAGAAGGGCTGGTAGGAACTAGG - Intergenic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1101276962 12:103213445-103213467 TAGAAGGGCTTGAATTAATTTGG + Intergenic
1103011435 12:117461351-117461373 TGGCAGGGCTGGATGGTATTGGG - Exonic
1103042870 12:117710270-117710292 TAGAAGGCCTCGAGGGCATCTGG + Intronic
1103648075 12:122410946-122410968 TAGAAGTGCTGGTGAGGATTTGG + Intronic
1103965915 12:124639218-124639240 GAGAAGGCCTGGGGTGAATTGGG - Intergenic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1105440589 13:20412722-20412744 CAGAAGGCTTGGGGGGAATTAGG - Intronic
1106251576 13:27986141-27986163 CAAAATGGCTGGAGGGAGTTTGG - Intronic
1107814353 13:44231207-44231229 TAGGAGGGATGAAGGGAATGGGG - Intergenic
1108238460 13:48434714-48434736 TAGAGAGGCTGGAGGGATATGGG - Intronic
1108317816 13:49255083-49255105 TAGAGTGTCTGAAGGGAATTTGG - Intronic
1112253426 13:97805435-97805457 TAGAAGGGGAGGAGGGAAAACGG + Intergenic
1113488851 13:110676586-110676608 TAGAAGAGCTGGCGGGAAGGCGG + Intronic
1114658513 14:24330340-24330362 CAGAAGGGTAGGAGGGAGTTGGG + Intronic
1115389980 14:32843192-32843214 TACAAGGGCTGGGAGGAAATGGG - Intergenic
1115497820 14:34024529-34024551 GAGAAGGGCTGGAAGGAAAGGGG - Intronic
1118047259 14:61984147-61984169 CAGAAGGGGTGGAGGCATTTGGG - Intergenic
1118527053 14:66657214-66657236 TTGTAGGGCTGAAGAGAATTCGG - Intronic
1119876659 14:78065593-78065615 TAAAAGGGATAGAGGGAAATAGG + Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1121766043 14:96486605-96486627 TAGAAAGTCTGGAGGGCATTGGG - Intronic
1121996639 14:98608105-98608127 TTGAAGGGCTGGACGGGAGTGGG - Intergenic
1122260123 14:100513308-100513330 TAAAAGGGCTGGAGGGAACAAGG + Intronic
1122467774 14:101946118-101946140 TGCAAGGGCAGGAGGGAGTTGGG - Intergenic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125682270 15:41539002-41539024 TAGGAGAGCTGGAGGGAAATGGG + Intronic
1126560315 15:50035982-50036004 TAAAATGGCTGGAGGGGATCTGG - Intronic
1127362685 15:58258991-58259013 TGAAAGGGCTGGAGGGAACTAGG - Intronic
1127444094 15:59042534-59042556 TACAAGGACTGGGGGGAAATGGG - Intronic
1127885432 15:63195499-63195521 GAGAAAAGCTGGAGGGAAATAGG + Intronic
1128157660 15:65401986-65402008 TAGAAGGGCAGGAGAGAAAGGGG + Intronic
1133699041 16:8291947-8291969 TAGAAGGTATGGAGGGGAGTGGG + Intergenic
1133792623 16:9020791-9020813 TAAAAGGGCTGGAGGAAACAAGG + Intergenic
1134439920 16:14293268-14293290 AAGAAGGGAGGGAGGGAATGGGG - Intergenic
1134890494 16:17837488-17837510 TACGAGGGCTGGAGGGGAGTCGG - Intergenic
1135174157 16:20213240-20213262 TAAAAGGGCTGGTAGGAATGAGG + Intergenic
1136238980 16:28932698-28932720 GAGAGGGGCTGGAGGGATTGAGG + Intronic
1137390310 16:48075789-48075811 TGGATGCGCTGGAGGGAACTTGG + Intergenic
1140725459 16:77807541-77807563 TAGATGGGCAGGAGGGAAGCTGG - Intronic
1141892109 16:86933199-86933221 AAGAAGGGAAGGAGGGAAATGGG + Intergenic
1142945448 17:3422650-3422672 TAGAGGGGCTGGAGAGAATCAGG - Intergenic
1143437434 17:6939739-6939761 TAGCAGGGCTGGAGGGAGAGTGG + Intronic
1144800687 17:17924254-17924276 TGGAAGGGCTGGGGGAAATGGGG + Intronic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1147915777 17:43884780-43884802 TAGAAGGAATGATGGGAATTAGG - Intronic
1149084489 17:52698846-52698868 CAGAAGAGCTGTAGGAAATTTGG - Intergenic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1151513004 17:74573164-74573186 TAGAAGGTATGCAGAGAATTAGG - Intergenic
1151546533 17:74796733-74796755 TTGCAGGTCTGGTGGGAATTTGG + Intronic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1153322093 18:3783613-3783635 GGGGAGGGCTGGAGGGAAATGGG + Intronic
1156202705 18:34852629-34852651 TGGAATGGCAGGAGGGAATCAGG - Intronic
1156817683 18:41330280-41330302 TTGTAGACCTGGAGGGAATTTGG - Intergenic
1157563204 18:48663123-48663145 AAGAAGGGCTGGAGGGCATCAGG + Intronic
1158624463 18:59059263-59059285 TGGAGGGGCCTGAGGGAATTTGG + Intergenic
1158661550 18:59393051-59393073 GAGAAGAGATGGAGGGAAATGGG - Intergenic
1159894003 18:73979620-73979642 TAAAAGGATTTGAGGGAATTGGG - Intergenic
1160015645 18:75138361-75138383 TGAAAGGGCTGGAGTGAGTTTGG - Intergenic
1160015655 18:75138432-75138454 TGAAAGGGCTGGAGGGAGTTTGG - Intergenic
1160367450 18:78339587-78339609 AAGGAGGGATGGAGAGAATTTGG - Intergenic
1160448406 18:78944819-78944841 AGGAAGGGATGGAGGGAATCGGG + Intergenic
1160609915 18:80076927-80076949 TGAAAGGGCTGGCGGGAACTAGG - Intronic
1161454207 19:4362067-4362089 TACAAGGGCTTGAGGGCATCTGG - Intronic
1165616524 19:37206545-37206567 TAGAAGGGCTGGAAGGCAAAAGG + Intronic
1166821734 19:45584589-45584611 GAAAAAGGTTGGAGGGAATTCGG + Intronic
925332392 2:3068674-3068696 GAGAAGAGTTGGAGGGAATGTGG + Intergenic
925933491 2:8730918-8730940 TCGATGAGATGGAGGGAATTAGG - Exonic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928947045 2:36780991-36781013 TAGAAGGGGTGGAGGGGAGGAGG - Intronic
929219161 2:39445604-39445626 GAGAAAGGCTGAAGGGGATTTGG - Intergenic
929962044 2:46504299-46504321 AAGAAGGGGAGGAGGGAACTGGG - Intronic
929984121 2:46709415-46709437 TTCAAGTGCTGAAGGGAATTTGG + Intronic
930390916 2:50761040-50761062 AAGAAGGGCTTGACAGAATTAGG - Intronic
930393885 2:50795578-50795600 TATATGGGAGGGAGGGAATTGGG - Intronic
930511656 2:52352859-52352881 TGGAAGGGCTAGAGAGAATTTGG - Intergenic
931986598 2:67748119-67748141 TAGGAGGGCTTGAGGGACTGTGG - Intergenic
932638550 2:73416337-73416359 TAGAAGGGATTGAGGTATTTTGG + Intronic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
934942168 2:98510593-98510615 TGAAAGGGCTGGAGGGAACTAGG - Intronic
937013257 2:118580767-118580789 CAGAAGAGCTGGAAGGAACTAGG - Intergenic
937127491 2:119483809-119483831 TAGCCAGGCTGGAGGGAATGTGG + Intronic
940549816 2:155139829-155139851 CAGAAAGGCCGGAGGAAATTAGG - Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
941490460 2:166137158-166137180 GTGAAGGGCTGGTGGGAACTGGG + Intergenic
946194788 2:218026654-218026676 GAAAAGGGCTGGAGGGAGGTAGG - Intergenic
946340363 2:219062696-219062718 TAGAGGGGCAGGAGGGAAAGGGG - Intergenic
946354100 2:219174104-219174126 AAGAAGGGCTCGAGGGATTTGGG - Intronic
947450953 2:230208476-230208498 TAGAAGAGAAGGAGGGAACTCGG + Intronic
1169639852 20:7739622-7739644 TAAAAGGGCTAGAGGGAACTGGG - Intergenic
1170170366 20:13404080-13404102 GAAAAGGGCATGAGGGAATTTGG - Intronic
1170540021 20:17378409-17378431 TCGAAGGGCTTTAGGGAATTTGG - Intronic
1171026602 20:21636446-21636468 TAGAAGGGATGTAGAGAAATAGG + Intergenic
1171344105 20:24452690-24452712 AAGGAGGGCTGGAGGGAAAGGGG - Intergenic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171885139 20:30646566-30646588 GAGGAGGGTTGGAGGGGATTGGG - Intergenic
1173417499 20:42869913-42869935 TAAAAGAGCTGGAGGGAACTAGG + Intronic
1174082899 20:47983459-47983481 TGGAAGGGCAGGAGGGACTGGGG + Intergenic
1174133057 20:48359524-48359546 TGGAAGGGCAGGAGGGACTGGGG - Intergenic
1176066374 20:63198553-63198575 TATAAGGGCTGAAGGGAGATGGG - Intronic
1177562831 21:22778902-22778924 TGAAAGGGCTGGAGGAAATTAGG - Intergenic
1178503588 21:33145435-33145457 TGGAAGGGCTGGAGGGGAGAGGG + Intergenic
1178681695 21:34677770-34677792 TAAAAGGCCTGGAGGGGGTTGGG - Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1181588782 22:23869926-23869948 TAAAAGGGCTGGAGGGAACTAGG - Intronic
1181773789 22:25145306-25145328 TAGGAAAGCTGGAGGGAGTTGGG + Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183016254 22:34990141-34990163 TAGAAAGTATGGAGGGAATAAGG + Intergenic
1183089201 22:35509776-35509798 TGGAGGGGCTGGGGGGATTTGGG - Intergenic
1183310788 22:37108512-37108534 CAGAAGGGCAGGAGGGAGTGAGG - Intronic
1183465228 22:37976905-37976927 CAGAATGGCTGGTGGGATTTGGG + Intronic
1184975351 22:48057776-48057798 TACAAGGGTTGGAGGGAGGTGGG + Intergenic
949892067 3:8740685-8740707 AAGAGAGGCTGGAGGGAACTAGG + Intronic
951025355 3:17822564-17822586 TCGAAAGGCTGGAGAGTATTTGG - Intronic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
953356195 3:42258135-42258157 TACATGGGCTGGATGGATTTTGG - Exonic
954211581 3:49100533-49100555 TAGAAGGGCTGGTGGTTAGTGGG - Intronic
955191478 3:56765695-56765717 TAGCAAGGGTGGAGGGATTTGGG - Intronic
960046969 3:113208468-113208490 TGAAAGGGGAGGAGGGAATTAGG + Intergenic
960552782 3:118994984-118995006 TTGAAGGGCTGAAAGAAATTTGG + Intronic
963766692 3:149343507-149343529 TAGAAGACCTGGAGGGACTCTGG - Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
965685895 3:171302099-171302121 TAAAAGGGGTGGAGGGGAGTGGG + Intronic
967274887 3:187764651-187764673 TAGAAGGGACAGAGTGAATTTGG + Intergenic
967482678 3:189991937-189991959 CAAAAGGGGTGGAGGGAGTTAGG + Intronic
967666671 3:192181007-192181029 AAAAAGGGCTGGATGGAATGAGG + Intronic
967678685 3:192333160-192333182 TATAAGGGAAGGAGGGAGTTTGG - Intronic
968087074 3:195878650-195878672 TGGATGGGCTGGAGGGAAGGCGG - Intronic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
968923854 4:3536714-3536736 TGGAAGGGTTTGAGGGAACTGGG - Intergenic
970249021 4:14094491-14094513 TAGGAGGGCTGGTGGGAAAGGGG - Intergenic
971537378 4:27770895-27770917 AAGAAAGGCTGCAGGGAGTTTGG + Intergenic
972285966 4:37648476-37648498 TAGCAGGGCTGAAAGGAATAGGG + Intronic
972926299 4:44013300-44013322 TAAAAGGGCTGGAGAGAATGAGG + Intergenic
973368791 4:49228834-49228856 GAGGAGGGTTGGAGGGGATTGGG - Intergenic
973392252 4:49566580-49566602 GAGGAGGGTTGGAGGGGATTGGG + Intergenic
974723850 4:65774258-65774280 AAGCTGGGCTGAAGGGAATTTGG - Intergenic
975308817 4:72879405-72879427 TAGAAGGGATGGGGAGAAATAGG - Intergenic
976355342 4:84110822-84110844 GAGAAGGGAAGGAGGGAGTTGGG - Intergenic
978826249 4:113027474-113027496 TAGAAGGGCTGCAGGTAAACAGG - Intronic
978827868 4:113046512-113046534 TAAAAGGGGTGGAGGGAACTAGG + Intronic
978865067 4:113497423-113497445 TAGAAGAGCTGAAGGAAAATGGG + Intronic
979447241 4:120828595-120828617 TTTATGGGCTGAAGGGAATTTGG + Intronic
981031202 4:140127423-140127445 CAGAAAGTGTGGAGGGAATTTGG + Intronic
981353868 4:143764773-143764795 TATAAGTGCTGGAGGAAACTAGG + Intergenic
981407479 4:144387805-144387827 TAAAAGGGCTAGAGGGGACTAGG - Intergenic
982321039 4:154077846-154077868 GAGAAGGGCAGGAGGGAAATGGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985988994 5:3539642-3539664 TGGAAGGGCTGGTTGTAATTTGG + Intergenic
986694371 5:10338980-10339002 GGGAAGGGCAGGAGGGAAGTTGG + Intergenic
987213601 5:15709880-15709902 CAAAAGGGCTCCAGGGAATTAGG - Intronic
987645925 5:20672315-20672337 GAGAAGAGTTGGAAGGAATTTGG + Intergenic
987885077 5:23802084-23802106 TAGCAGGCATGGAGTGAATTGGG + Intergenic
990608060 5:57429927-57429949 CCAAAGAGCTGGAGGGAATTTGG - Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
991514841 5:67423920-67423942 TAAAAGAGCTGGAGGAAACTAGG + Intergenic
992017666 5:72592357-72592379 TAGAGGGGCAGGAGGGAAACCGG + Intergenic
992408371 5:76481022-76481044 TAAAAGGGCTGGAGGGAACTAGG - Intronic
994115271 5:96054843-96054865 TAGAAGGCCTGGTGTGAATCAGG + Intergenic
995726384 5:115185337-115185359 TAGAGGGGCTGGAGAGAGTCTGG + Intergenic
997952386 5:138252786-138252808 GAGATGGGGTGGAGGGAATGAGG + Exonic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
999909730 5:156184695-156184717 TAGCAGAGCAGGAGGGAATAAGG - Intronic
1000345537 5:160311129-160311151 GAGAAGGGCTGAGGGGCATTGGG - Intronic
1000831284 5:166103689-166103711 TTTGAGGGGTGGAGGGAATTTGG - Intergenic
1002107752 5:176888558-176888580 TAGAGGGGCTGGAGGGGAAAGGG + Exonic
1002846369 6:948689-948711 TGGTGGTGCTGGAGGGAATTAGG + Intergenic
1004774619 6:18829678-18829700 TAGAATGGCTATAGGAAATTAGG + Intergenic
1005940226 6:30555373-30555395 CAGAGGGGCTGGAGAGAGTTGGG - Intronic
1005992519 6:30912262-30912284 AAGAAGGGCTTGAGGGAGTCTGG + Intronic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007515183 6:42405243-42405265 TACAAGGAAGGGAGGGAATTTGG + Intronic
1007589836 6:43014364-43014386 TAGAAGGGCAAGGGAGAATTAGG + Intronic
1007695378 6:43729141-43729163 TGGCATGGCTGGAGGGCATTGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008386141 6:50892875-50892897 TAGGAAGGTTGGAGAGAATTTGG + Intergenic
1009686403 6:66963194-66963216 TAAAAGGGCTGAAGGGAACTAGG + Intergenic
1010103600 6:72141357-72141379 TTGAGGGGGAGGAGGGAATTTGG - Intronic
1010188342 6:73167834-73167856 TAGAAGGGCTGGAGTGAACTAGG - Intronic
1012865389 6:104612337-104612359 TAGAAGGGCAGGAAGGAGTTAGG - Intergenic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1015358938 6:132314056-132314078 TAGAATGGCTGGTGGAAATTTGG - Intronic
1015456359 6:133431113-133431135 GAGATGGGATGTAGGGAATTGGG + Intronic
1015911611 6:138173637-138173659 TAGAAGAGCTGGAGAGAATATGG + Intronic
1016184032 6:141178757-141178779 TAGAAGGACTAAGGGGAATTAGG + Intergenic
1020565756 7:9793584-9793606 ACGAAGGGCTGGAGTGAACTAGG - Intergenic
1021329940 7:19324012-19324034 TAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1021958225 7:25847746-25847768 AAGAAGGGGTAGAGGGACTTTGG - Intergenic
1029203016 7:98851616-98851638 GAGGAGGGCTGCAGGGAAATGGG + Exonic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031985870 7:128164438-128164460 CACAAGGGTAGGAGGGAATTAGG - Intergenic
1032353724 7:131189892-131189914 TAGGAGGGCTGGGGGCAATAGGG + Intronic
1032366483 7:131304936-131304958 TAAAAGGGCTGGAAGGAGCTAGG + Intronic
1032584757 7:133135972-133135994 TGGAAGGGCTGGAGGCACTAGGG + Intergenic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1035149385 7:156854983-156855005 TAAAAGGGATTGAGGTAATTTGG - Intronic
1035662666 8:1359535-1359557 CCGAAGGCCTGGAGGGATTTGGG + Intergenic
1036477172 8:9103899-9103921 TAGAAGGGATGGAGAGAAAAAGG - Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1037407645 8:18560915-18560937 TAGAAGTGCTGGAGTGATATAGG + Intronic
1037958860 8:23081081-23081103 TAGAAGGAATGGAGGCAATAGGG + Intergenic
1038144465 8:24882173-24882195 TAAAAGGACTGGAGGGCACTGGG - Intergenic
1038855554 8:31328015-31328037 TAGAGGGGCTGTAGAGAAATAGG + Intergenic
1039611769 8:38924701-38924723 AAAAAGAGATGGAGGGAATTTGG + Intronic
1039692720 8:39879770-39879792 CAGATGGTCTGGAGGAAATTTGG + Intergenic
1040062408 8:43115222-43115244 TAGAAGGGATGGAAGGGATGAGG - Intronic
1040488310 8:47895624-47895646 GGGAAGGGCTGGAGGGCAGTGGG - Intronic
1040953386 8:52957239-52957261 TAGAAGGACTAAAGAGAATTAGG + Intergenic
1042011217 8:64246797-64246819 TTGAAGAGCTGGAGGGATTGTGG - Intergenic
1044568337 8:93689826-93689848 TGGGAGGTCTGGAGGGAAATAGG + Intergenic
1044833724 8:96275791-96275813 TAGAATGGCTGAGGGGAATGGGG - Intronic
1045497002 8:102717433-102717455 GAGAAGGGCTGCAGGGGATGGGG - Intergenic
1045858544 8:106791153-106791175 TAGAAGGACTAGGGAGAATTAGG + Intergenic
1048791096 8:138104326-138104348 TAAACAGGCTGGAGGCAATTGGG - Intergenic
1050062195 9:1721089-1721111 TAGAAAGGCAGGAGTGCATTGGG + Intergenic
1050176170 9:2871479-2871501 TATGAGGGCTGGAGGGAAACTGG + Intergenic
1050342592 9:4655377-4655399 TAGGAGGGCTGGTGGGGAATAGG + Intronic
1051592818 9:18793783-18793805 TAGAAGGGTTGGAGGGACAATGG - Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052381305 9:27773801-27773823 CAGAAGGGCTGCAGTGAGTTTGG - Intergenic
1052963729 9:34322326-34322348 TAGATGGGTTGGGGGGAAATTGG - Intronic
1053163210 9:35827951-35827973 GAGAAGGGGAGGAGGAAATTGGG + Intronic
1053799568 9:41755739-41755761 TGGAAGGGTTTGAGGGAACTGGG - Intergenic
1054145651 9:61559259-61559281 TGGAAGGGTTTGAGGGAACTGGG + Intergenic
1054187977 9:61967799-61967821 TGGAAGGGTTTGAGGGAACTGGG - Intergenic
1054465390 9:65490363-65490385 TGGAAGGGTTTGAGGGAACTGGG + Intergenic
1054650538 9:67620782-67620804 TGGAAGGGTTTGAGGGAACTGGG + Intergenic
1055399171 9:75905141-75905163 TGGAAGGGTTGGTGGGAAATGGG + Intronic
1055616870 9:78082158-78082180 TAAAAGGGCTCGAGGGAACTAGG + Intergenic
1055822067 9:80277880-80277902 TAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1058564182 9:106263390-106263412 TAAAAGTTCTGGAGGGAATGGGG - Intergenic
1059541778 9:115137432-115137454 TTGCAGGGATGGAGGGAATTGGG + Intergenic
1060825736 9:126686959-126686981 TAGAAGGGCTGGCCGGAACCCGG + Intronic
1061050227 9:128191033-128191055 TAGCAGGACTGGAGGTAACTTGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1187250671 X:17595138-17595160 TAGAAGTTCTGTAGGGATTTTGG + Intronic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1188422066 X:30002339-30002361 TAGAGTGGCTGGAGAGACTTAGG + Intergenic
1190109891 X:47582909-47582931 TTGAAGGGGTTGGGGGAATTTGG - Intronic
1190843567 X:54169569-54169591 TAGAGGGGCTTGAGGGAATATGG - Intronic
1192482772 X:71499599-71499621 TAGAAGGACTAAAGAGAATTAGG - Intronic
1192484955 X:71517036-71517058 TAAAAGGGCGGGAGGGAACTGGG + Intronic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1198619179 X:138487893-138487915 GAGAAGAGCTGGATGGAATCTGG - Intergenic
1200694984 Y:6350843-6350865 TAGAAGGACTGAGGAGAATTAGG - Intergenic
1200783459 Y:7237858-7237880 TAGAAGGCTTGGAGGCAAGTGGG + Intergenic
1201040293 Y:9823867-9823889 TAGAAGGACTGAGGAGAATTAGG + Intergenic
1201407138 Y:13660726-13660748 TGGATGGTCTGGAGGAAATTTGG + Intergenic