ID: 1145199206

View in Genome Browser
Species Human (GRCh38)
Location 17:20925826-20925848
Sequence CAGTATTTGCCTTTTGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145199205_1145199206 10 Left 1145199205 17:20925793-20925815 CCATGCAAGATGCTACATATAAA No data
Right 1145199206 17:20925826-20925848 CAGTATTTGCCTTTTGTAAATGG No data
1145199204_1145199206 11 Left 1145199204 17:20925792-20925814 CCCATGCAAGATGCTACATATAA No data
Right 1145199206 17:20925826-20925848 CAGTATTTGCCTTTTGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145199206 Original CRISPR CAGTATTTGCCTTTTGTAAA TGG Intergenic
No off target data available for this crispr