ID: 1145201016

View in Genome Browser
Species Human (GRCh38)
Location 17:20944751-20944773
Sequence AGGGAGAGCTCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145201016_1145201026 26 Left 1145201016 17:20944751-20944773 CCCACAATCACTGAGCTCTCCCT No data
Right 1145201026 17:20944800-20944822 GCACCACGTGTGGCTGCTGCCGG No data
1145201016_1145201024 16 Left 1145201016 17:20944751-20944773 CCCACAATCACTGAGCTCTCCCT No data
Right 1145201024 17:20944790-20944812 TTCCGTCTAAGCACCACGTGTGG No data
1145201016_1145201027 27 Left 1145201016 17:20944751-20944773 CCCACAATCACTGAGCTCTCCCT No data
Right 1145201027 17:20944801-20944823 CACCACGTGTGGCTGCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145201016 Original CRISPR AGGGAGAGCTCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr