ID: 1145203217

View in Genome Browser
Species Human (GRCh38)
Location 17:20966041-20966063
Sequence CTGAGTTAACATATGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145203217_1145203224 14 Left 1145203217 17:20966041-20966063 CCCCCTTCCATATGTTAACTCAG No data
Right 1145203224 17:20966078-20966100 TCAGGGACATGTTCAGCTCCAGG No data
1145203217_1145203223 -3 Left 1145203217 17:20966041-20966063 CCCCCTTCCATATGTTAACTCAG No data
Right 1145203223 17:20966061-20966083 CAGTAATGAACTTGTGTTCAGGG No data
1145203217_1145203225 26 Left 1145203217 17:20966041-20966063 CCCCCTTCCATATGTTAACTCAG No data
Right 1145203225 17:20966090-20966112 TCAGCTCCAGGTAATATTGTAGG No data
1145203217_1145203222 -4 Left 1145203217 17:20966041-20966063 CCCCCTTCCATATGTTAACTCAG No data
Right 1145203222 17:20966060-20966082 TCAGTAATGAACTTGTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145203217 Original CRISPR CTGAGTTAACATATGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr