ID: 1145210688

View in Genome Browser
Species Human (GRCh38)
Location 17:21011120-21011142
Sequence CGCCCCCGCCGTGTGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145210681_1145210688 10 Left 1145210681 17:21011087-21011109 CCTGATGGAGCACAGCCTTCTGG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG 0: 1
1: 1
2: 2
3: 12
4: 125
1145210680_1145210688 21 Left 1145210680 17:21011076-21011098 CCTGCTTTGGTCCTGATGGAGCA 0: 1
1: 0
2: 2
3: 9
4: 109
Right 1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG 0: 1
1: 1
2: 2
3: 12
4: 125
1145210684_1145210688 -5 Left 1145210684 17:21011102-21011124 CCTTCTGGCCAGGAGACACGCCC 0: 1
1: 1
2: 2
3: 16
4: 134
Right 1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG 0: 1
1: 1
2: 2
3: 12
4: 125
1145210679_1145210688 22 Left 1145210679 17:21011075-21011097 CCCTGCTTTGGTCCTGATGGAGC 0: 1
1: 0
2: 2
3: 15
4: 189
Right 1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG 0: 1
1: 1
2: 2
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145210688 Original CRISPR CGCCCCCGCCGTGTGGGTGC AGG Intronic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
901776697 1:11565180-11565202 TGCCCTTGCCCTGTGGGTGCAGG - Intergenic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902505967 1:16939196-16939218 CGCGCCCTCCGGGTGGGGGCGGG + Intronic
902565441 1:17308264-17308286 CACCCATGCCGTGTGTGTGCTGG + Exonic
903154959 1:21436864-21436886 CGCGCCCTCCGGGTGGGGGCGGG + Intergenic
903492903 1:23743306-23743328 CGCGGCCGCCGGGTGGGCGCTGG + Exonic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
907188908 1:52632952-52632974 TGACCCCGCCGTGTGGTCGCCGG + Intergenic
910387837 1:86704591-86704613 CGACCCCGCCGTGTGGACCCGGG - Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1066220755 10:33335115-33335137 CGCCCCGGTCGCGTGGGTGCGGG + Intronic
1072903574 10:99430652-99430674 CGCCCCCGCCGGCTAGGTGAAGG - Intergenic
1076697287 10:132253066-132253088 CGTCCCTGCTGTCTGGGTGCTGG - Intronic
1076721852 10:132396555-132396577 CGCCCTCGCCGCGTGGGGGGCGG - Intergenic
1077058428 11:607228-607250 CGCCCCCGCGGTGCGGGCGGGGG - Exonic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079313754 11:19390171-19390193 GGGCCCAGCTGTGTGGGTGCTGG + Intronic
1080836308 11:35944089-35944111 CGGCCGCGCCATGTGGCTGCTGG + Exonic
1081774078 11:45665771-45665793 TGCCCCCGGCGGGTGGGTGGGGG - Intergenic
1083623452 11:64060015-64060037 CCCCCCTGCCGTGTGGGAGGGGG - Intronic
1084161766 11:67353944-67353966 CCGCCCCGCCTTGTGGGGGCAGG + Intronic
1084546228 11:69816451-69816473 CGCCCCCTCCGTGGGGGCGGCGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091750895 12:3020678-3020700 CGGCCCTGCCATGGGGGTGCCGG - Exonic
1095559771 12:43551605-43551627 CGCCCCCGCCGTGTGGTCCTGGG + Intronic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1096981240 12:55729076-55729098 CTCCCCCGCCGAGTGGCCGCCGG + Intronic
1101641374 12:106587492-106587514 CCCCGCCGCTGTGTGAGTGCTGG + Intronic
1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG + Intronic
1108409730 13:50133825-50133847 CGCCTTCGCCTTCTGGGTGCGGG + Intronic
1108555268 13:51584986-51585008 CGCCTCCGCTGTGTGGCTCCGGG + Intronic
1113424111 13:110193751-110193773 TGCCCCCGAAGTGTGGGAGCAGG + Intronic
1113430764 13:110248426-110248448 CGCCCCTGCCGTGTGGCCGTGGG - Intronic
1119380626 14:74225948-74225970 CCCCCGCGCACTGTGGGTGCTGG - Intergenic
1119500927 14:75126909-75126931 GGCCGCCGCCATGTCGGTGCTGG - Exonic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1123705953 15:22951375-22951397 AGCCCCGGCCGGGTGGGTGCAGG + Intronic
1127497224 15:59524598-59524620 CCCTCCCGCTGTGTGTGTGCTGG - Intergenic
1129189250 15:73927799-73927821 CGCCCCCGCCGGGTGGGGAGCGG + Exonic
1130348142 15:83067361-83067383 CGCCCCTGCCCTGGGGCTGCCGG - Intergenic
1132455969 16:23103-23125 CGCCCCCGCTGTGAGTGTGGCGG + Intergenic
1132484001 16:180908-180930 GGCCCCGGCGGGGTGGGTGCGGG + Intronic
1132552053 16:557570-557592 TGCCCTCACTGTGTGGGTGCAGG + Intergenic
1134070592 16:11257214-11257236 AGCCCCGGCCGTGTGTGTGGTGG - Intronic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139511488 16:67430818-67430840 GGCCCCGGGCGTGTGGGTGGGGG + Intronic
1141482018 16:84313142-84313164 CGCCCCCGCCAGGTAGGTCCTGG + Exonic
1143015403 17:3888835-3888857 CGCCCCGGCCGCGTGTGTGAGGG + Intronic
1143966770 17:10761130-10761152 CTCCCCCGCCGTGTGAGTGCCGG - Intergenic
1144758705 17:17695045-17695067 GGCCCCTGCCGTGGGGTTGCCGG - Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1145876174 17:28319553-28319575 CGCCCCCGCCGCTTGGGAGAAGG - Intronic
1145970151 17:28951418-28951440 CGCCGCCGCCGTCTGCGTCCCGG + Exonic
1148742833 17:49902366-49902388 CGCGCTTGCCGGGTGGGTGCAGG + Intergenic
1151662502 17:75526108-75526130 TGCCCCGGCCGGCTGGGTGCGGG + Intronic
1152829675 17:82489442-82489464 CGCACCAGCTGGGTGGGTGCAGG + Exonic
1160521079 18:79508355-79508377 CGCCGCTGCCCTGTGGCTGCTGG - Intronic
1161479244 19:4502465-4502487 CCCCCCAGCCTCGTGGGTGCGGG - Exonic
1162145594 19:8610911-8610933 CGCCCCCGCCGCGTGGGAGGGGG + Intergenic
1163645844 19:18488541-18488563 AGCCCCCGCCCCGTGGATGCTGG - Intronic
1163799570 19:19356421-19356443 CCATCCCGCCGTGGGGGTGCAGG + Exonic
1165104718 19:33462125-33462147 AGCCCCGGCCCTGGGGGTGCTGG - Intronic
1166851459 19:45763439-45763461 CGGCCCCGAGGTGTGGGTGGGGG + Intronic
1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG + Exonic
1168294967 19:55373838-55373860 CGTCCCCGCAGTGTGGCTGCAGG + Intergenic
926077159 2:9951174-9951196 CGCCCCCGCCGGGCGAGCGCAGG + Intergenic
933567542 2:83969306-83969328 CGAGCCCTCCTTGTGGGTGCTGG + Intergenic
933703457 2:85272860-85272882 CGCTCCTGCCCTGTGGCTGCAGG - Intronic
938493713 2:131779872-131779894 AGCCTCCGCCTTGTGGGTTCAGG - Intergenic
940640548 2:156341663-156341685 CGCCCCCGCCCTGCGGGAGGAGG - Intronic
946382406 2:219358223-219358245 CCCCGCCGCTGTGTGGGTCCAGG - Intergenic
948207254 2:236168698-236168720 CGGCCCAGCCGTGGGGGTGCGGG - Intergenic
948599183 2:239098477-239098499 GGCCCCTGGCGAGTGGGTGCCGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1168965313 20:1894935-1894957 CGCCCGCGCCGTGTGGAGCCCGG + Intronic
1173454205 20:43190163-43190185 CCTGCCCGGCGTGTGGGTGCGGG - Intergenic
1173548023 20:43914456-43914478 CCGCCCCGCGGCGTGGGTGCGGG - Intergenic
1176236632 20:64056562-64056584 AGCCCCCGCTCTGTGGTTGCAGG + Intronic
1176298568 21:5087653-5087675 CGCCCCTGCCCTGTGGGTCTGGG - Intergenic
1179486876 21:41716106-41716128 CGCCCCCACCTTGTGGTTTCTGG - Intergenic
1179858458 21:44174296-44174318 CGCCCCTGCCCTGTGGGTCTGGG + Intergenic
1179886376 21:44315940-44315962 AGCCCCAGCTGTGTGTGTGCTGG + Intronic
1180057177 21:45365027-45365049 CGGCCCTGCCGTGAGGATGCTGG - Intergenic
1180162302 21:46003527-46003549 CGCCCACGACGTGCGGGTGGCGG + Exonic
1180955830 22:19740809-19740831 CGCCCGGGCCTTGTGGGGGCAGG + Intergenic
1183476679 22:38039513-38039535 CACCCCCGCCTTGTGAGAGCCGG + Intronic
1183521895 22:38300470-38300492 CTCCTCCGCCCTGTTGGTGCAGG - Intronic
1183746574 22:39695194-39695216 CGCCCCCTCCCTGTGGTTGCAGG - Intergenic
1184004708 22:41699697-41699719 GGACCCCGGCGTGTCGGTGCGGG + Exonic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
952861774 3:37818777-37818799 CTCCCCAGCCCTGTGAGTGCAGG + Intronic
961484561 3:127207904-127207926 CTCCCACACAGTGTGGGTGCTGG - Intergenic
961547991 3:127649295-127649317 GTCCCCTGCCATGTGGGTGCTGG + Intronic
968612735 4:1564510-1564532 AGCCCCCTCGGTGTGGGTCCGGG + Intergenic
969503523 4:7569687-7569709 CGGCCCCGCCCTGTGGTGGCTGG - Intronic
969688584 4:8690710-8690732 TGCCACGGCCGTGTGGCTGCAGG + Intergenic
974047275 4:56908360-56908382 CGGCCCCGCCGGGCGGGGGCTGG + Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
985784503 5:1886880-1886902 CGCCCGCGCCGTGTGGCTGCCGG + Exonic
986566650 5:9122697-9122719 CGGCCCCGCAGTGTGGTGGCTGG - Exonic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
999185309 5:149703101-149703123 CCCTCCAGCCTTGTGGGTGCTGG - Intergenic
1001576158 5:172765326-172765348 CGCGCCCGCCGGGTGGATCCAGG - Intergenic
1001647842 5:173295429-173295451 GGCCCCCTCCTTGTGGGTGGGGG + Intergenic
1002046210 5:176543116-176543138 AGCTCCCGCCGTGCGGGCGCCGG + Intronic
1002061110 5:176626644-176626666 CGCCCCCGCCCTCTGGTTCCCGG + Intronic
1002771294 6:292495-292517 CGCCCCGGCCGTGTGGTCGCAGG - Exonic
1006151023 6:31989860-31989882 CTCCTCAGCCGAGTGGGTGCAGG - Intronic
1006157324 6:32022598-32022620 CTCCTCAGCCGAGTGGGTGCAGG - Intronic
1007849753 6:44791791-44791813 CGCCCCCTCCTTGGGGGAGCGGG - Intergenic
1015843857 6:137497812-137497834 CGCCCCAGCCGCGAGGGCGCGGG - Intergenic
1016400851 6:143678233-143678255 CGCTCCCGCCGCGCGGGCGCAGG + Intronic
1017793903 6:157823877-157823899 CGCCCCCGCGGGGCGGGTGGGGG + Intronic
1020461397 7:8433668-8433690 CGCCTCCGACCTGTGGCTGCCGG - Intergenic
1021991901 7:26148275-26148297 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991924 7:26148322-26148344 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991947 7:26148369-26148391 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1024579920 7:50793242-50793264 CGCCGCCTCCGCGTGGCTGCGGG + Intronic
1027001831 7:74658839-74658861 CACTCCCGTCGTCTGGGTGCTGG - Intronic
1030262422 7:107579988-107580010 CGGCCCCGGCGGGAGGGTGCCGG - Intronic
1033118270 7:138645247-138645269 TTCCTCCACCGTGTGGGTGCTGG - Intronic
1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG + Exonic
1033655652 7:143372219-143372241 CCACCCAGCTGTGTGGGTGCAGG + Intergenic
1034966684 7:155395671-155395693 CGGCCCCGCAGTGTGAGTGCTGG - Exonic
1035225963 7:157432356-157432378 CGCACTCTCCGTGTGGGTGATGG - Intergenic
1039630546 8:39107536-39107558 CACCCCAGCCGCGTGGTTGCTGG - Intronic
1049044289 8:140137110-140137132 TGCCCGAGCCCTGTGGGTGCTGG - Intronic
1049326120 8:142022402-142022424 GGCCACCGGGGTGTGGGTGCTGG + Intergenic
1049370424 8:142261658-142261680 CGGCCCCGGGGTGGGGGTGCAGG + Intronic
1049803026 8:144526982-144527004 CTCCCCCGCCGTGCAGGTGGCGG + Exonic
1056548876 9:87635281-87635303 TGCGCCAGCTGTGTGGGTGCTGG + Intronic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1061257545 9:129461136-129461158 CGCCCCCGCCGGCTGTCTGCTGG + Intergenic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1061391770 9:130320798-130320820 CGCCCCCACCGTCCGGGTCCTGG + Intronic
1061540657 9:131276639-131276661 CGACCGCGCCGGGCGGGTGCGGG - Intergenic
1062120165 9:134829854-134829876 CCCCCCCGGCGTGAGGATGCAGG + Intronic
1062372162 9:136245605-136245627 CGAGGACGCCGTGTGGGTGCTGG - Exonic
1189487038 X:41442262-41442284 CGCCCCCACCGAGTAGGTGCGGG + Intergenic
1197034164 X:121854242-121854264 CTCCCCCAGCGTGTGTGTGCAGG + Intergenic