ID: 1145212990

View in Genome Browser
Species Human (GRCh38)
Location 17:21028940-21028962
Sequence CAGGATCAGGAGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 849
Summary {0: 1, 1: 0, 2: 7, 3: 100, 4: 741}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145212990_1145213003 15 Left 1145212990 17:21028940-21028962 CCCACCTCCTGCTCCTGATCCTG 0: 1
1: 0
2: 7
3: 100
4: 741
Right 1145213003 17:21028978-21029000 CCAGCTCCCATCCCCACTGCAGG 0: 1
1: 0
2: 10
3: 69
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145212990 Original CRISPR CAGGATCAGGAGCAGGAGGT GGG (reversed) Intronic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900373599 1:2343461-2343483 GAGGATCAGGAGCAAGATGAGGG - Intronic
900409247 1:2505346-2505368 CGGGAGCAGGGGCAGGAGGGAGG - Exonic
900409708 1:2507113-2507135 CAGGATGCCGAGGAGGAGGTGGG - Intergenic
900516048 1:3082668-3082690 CAGGATCTGGAGCTGGACCTGGG + Intronic
900566814 1:3337384-3337406 CAGCCTCAGGAGCAGCAGTTGGG - Intronic
900858262 1:5203709-5203731 CAGGAGCAGGAGGAAGAGGGTGG + Intergenic
901049691 1:6420001-6420023 CAGGAACAAAGGCAGGAGGTGGG - Intronic
901210173 1:7520197-7520219 GAGGAGGAGGAGGAGGAGGTCGG - Intronic
901407193 1:9057172-9057194 CAGGATCAGGAGGCTGAGGCAGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901464750 1:9413884-9413906 CAGGACCAGGGCCAGGAGGCTGG + Intergenic
901683785 1:10932013-10932035 CGAGAGCAGGAGCAAGAGGTGGG - Intergenic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902164336 1:14557838-14557860 CAGGCTCTGTAGCAGGAGCTGGG - Intergenic
902359769 1:15936002-15936024 CAGGAGCAGGGGCAGGAAGGGGG - Exonic
902409909 1:16206594-16206616 CAGGATCAGGGGCGGGACCTGGG - Intronic
902461240 1:16578646-16578668 CAGCATCAAGAGCAGGGAGTAGG - Intronic
902462022 1:16584942-16584964 CAGCATCAAGAGCAGGGAGTAGG - Intronic
902462791 1:16591300-16591322 CAGCATCAAGAGCAGGGAGTAGG - Intronic
902600213 1:17535851-17535873 CAGGTTCTGGAGCAGGTGCTGGG + Intergenic
902828650 1:18995454-18995476 GAGGAGGAGGAGGAGGAGGTAGG - Intergenic
903158750 1:21469422-21469444 CAGCATCAAGAGCAGGGAGTAGG + Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903446003 1:23423631-23423653 CTGGAACAGGAACGGGAGGTGGG + Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
905453927 1:38074647-38074669 AAGCATCTGGACCAGGAGGTTGG + Intergenic
905865916 1:41376575-41376597 CAGGATGAGAAGCAGGCAGTGGG - Intronic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191983 1:43904794-43904816 CAGGAAGAGGAACAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192010 1:43904899-43904921 CGGGAAGAGGAGCAGGAGGAGGG - Intronic
906192188 1:43905538-43905560 CAGGAATAGGAGCAGAAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906687050 1:47769552-47769574 CAGAATCAGGCCCAGGAGGTGGG - Intronic
906829037 1:49012371-49012393 CAGAATTATGAGCAGGTGGTTGG + Intronic
906841786 1:49147062-49147084 CAGGAGGTGGAGCAGGAGATAGG + Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907477016 1:54712612-54712634 CAGGACCAGGAGCAGGTTGTGGG + Intronic
907638234 1:56157966-56157988 CAGGTGCATGGGCAGGAGGTGGG + Intergenic
907709606 1:56866890-56866912 CATGATGAGGAGCAGGAAATGGG + Intronic
908267466 1:62393551-62393573 CAGGATCCAGAGCAGAAGGAAGG - Intergenic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908494018 1:64676825-64676847 AAGGACCAGGAGCATGAGTTTGG + Intronic
908819347 1:68067375-68067397 CAGAATCAGAATCTGGAGGTGGG + Intergenic
909180309 1:72415673-72415695 CAGGAGCAGGACCAAGAGGCAGG - Intergenic
909952684 1:81738164-81738186 CAGGATCCGGATCCGGATGTAGG + Intronic
910421548 1:87069082-87069104 CAGGCTGAGGAGGAAGAGGTGGG + Intronic
911051493 1:93675496-93675518 TAGGGTCAGGGTCAGGAGGTGGG + Intronic
911603262 1:99869989-99870011 CAGAATCAGAATCAGGAGTTTGG - Intronic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
912506684 1:110161508-110161530 CAGGATCAGGAGCACGGGGAGGG + Intronic
912566322 1:110590127-110590149 CAAGAGCAGGAGCAAGAGGGAGG + Intergenic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
913051323 1:115119323-115119345 CAGGAGCAGGACCAAGGGGTTGG + Intergenic
913534239 1:119755990-119756012 GAGGAACAGGAGCAGGAAGATGG - Intronic
913602686 1:120437222-120437244 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
913603434 1:120443575-120443597 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
913604178 1:120449924-120449946 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
913640288 1:120806290-120806312 CAGCATCAAGAGCAGGGAGTAGG + Intronic
913641054 1:120812620-120812642 CAGCATCAAGAGCAGGGAGTAGG + Intronic
913990899 1:143610694-143610716 CAGCATCAAGAGCAGGGAGTAGG - Intergenic
914084359 1:144439282-144439304 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914190369 1:145404557-145404579 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914212226 1:145590339-145590361 CAGCATCAAGAGCAGGGAGTAGG - Intergenic
914277429 1:146137689-146137711 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914278189 1:146144048-146144070 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914363858 1:146960843-146960865 CAGCATCAAGAGCAGGGAGTAGG + Intronic
914364612 1:146967198-146967220 CAGCATCAAGAGCAGGGAGTAGG + Intronic
914365377 1:146973485-146973507 CAGCATCAAGAGCAGGGAGTAGG + Intronic
914487071 1:148119954-148119976 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914487817 1:148126299-148126321 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914538477 1:148588637-148588659 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914539237 1:148594996-148595018 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914587405 1:149075110-149075132 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914588172 1:149081418-149081440 CAGCATCAAGAGCAGGGAGTAGG - Intronic
914627443 1:149476632-149476654 CAGCATCAAGAGCAGGGAGTAGG + Intergenic
914741966 1:150472755-150472777 CAGGAGGGGGAGGAGGAGGTGGG - Exonic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915641149 1:157227607-157227629 CAGGATCAGGGCCAAGGGGTAGG + Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915898317 1:159828267-159828289 CAGCACCAGGAGGAGCAGGTAGG + Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916890014 1:169105813-169105835 CAGGTGCAGGAGCGGGAGGCGGG + Exonic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917490293 1:175492976-175492998 CAATACGAGGAGCAGGAGGTGGG + Intronic
917612231 1:176700258-176700280 CAATATCTGGAGCAGGAGGCTGG + Intronic
918404963 1:184202950-184202972 CAGGAGCAGGAGCAAGAGAGAGG + Intergenic
918430458 1:184454665-184454687 CAGGAACAGGAGCAAGAGAGAGG - Intronic
919598171 1:199590415-199590437 CAGGCACATGTGCAGGAGGTAGG + Intergenic
920055727 1:203189942-203189964 CTGGATCAGGAGCCAGAGGGTGG + Intergenic
920215815 1:204360817-204360839 CAGGATCAGAGGCAGAAGGAAGG + Intronic
920340400 1:205272036-205272058 CAGGACGAGGACCAGGAGGGTGG - Exonic
921060251 1:211578961-211578983 CCGGAGCAGGAGCAGGAGGGCGG + Intergenic
921172346 1:212560695-212560717 CAGCATGAGGGGCAGGAGCTGGG - Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
922121310 1:222671850-222671872 CACGATCATGAGGAGGAGATGGG - Intronic
922211246 1:223488412-223488434 CAGGCTCTGGAGCATGTGGTTGG + Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
923994042 1:239471555-239471577 CAGGATCAGGAAGAGGGGCTAGG + Intronic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1062982525 10:1737182-1737204 CAGGTGCAGGTGCAGGAGGGAGG - Exonic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063214486 10:3912116-3912138 GAGGATCTGGAGCAGGAGCTCGG + Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063451283 10:6151923-6151945 CAGGAACAGGAGCTGCAGGAGGG - Intronic
1064234973 10:13565371-13565393 CCGGAGCAGGAGCAGGGGATGGG - Intergenic
1064564469 10:16625790-16625812 AAGGAGTAGGAGCAAGAGGTTGG + Intronic
1064623205 10:17235623-17235645 CAGGAGCATGAACAGGAGTTAGG - Intronic
1065223978 10:23524218-23524240 TAGGAGCAGGAGCAGGAGCAGGG + Intergenic
1065444106 10:25780044-25780066 CAGAAGCAGGAGCAAGGGGTTGG + Intergenic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065541950 10:26779317-26779339 CAGGATAAGTACCAGGAAGTAGG + Intronic
1065550414 10:26863804-26863826 GAGGAACAGGAGTAGGAGGAAGG + Intergenic
1065852312 10:29801041-29801063 CAAGAGCAGGAGCAAGAGGGAGG + Intergenic
1066719385 10:38321468-38321490 TAATATCAGAAGCAGGAGGTTGG - Intergenic
1067466489 10:46502957-46502979 CTGGACCAGGAGCAGGAGCTGGG + Intergenic
1067620699 10:47881648-47881670 CTGGACCAGGAGCAGGAGCTGGG - Intergenic
1067933861 10:50591337-50591359 CATGTTCGGGAGCAGGAGGGTGG - Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1069589485 10:69632962-69632984 CAGGAAGAGGAGCAGGATGGAGG - Exonic
1070749448 10:78955332-78955354 CAGGGTGAGGATCAGGAGGTAGG - Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1071119696 10:82263164-82263186 CAGTAGCAGTAACAGGAGGTGGG + Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072145552 10:92632963-92632985 CAGGGTCAGGAGCCGGAGTCAGG - Intronic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1072655913 10:97330368-97330390 CTGGATCAGTAGCAAGAGTTGGG + Intergenic
1072857975 10:98969926-98969948 CAAAAGCAGGAGCAAGAGGTGGG + Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073558054 10:104472596-104472618 AAGGAGCATGACCAGGAGGTGGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074134957 10:110618148-110618170 AAGGAGGAGGAGGAGGAGGTAGG + Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074972667 10:118551958-118551980 CAGGATTGGGAGCAGGAGTAGGG + Intergenic
1075135488 10:119781754-119781776 CAGGATCTTGAGCTAGAGGTAGG + Exonic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075579368 10:123605375-123605397 AAGGATCATGAACAGGAGGCAGG - Intergenic
1075649854 10:124120197-124120219 CAGGAACCGGTGCAGGAAGTCGG + Intergenic
1075902703 10:126055866-126055888 CATGCTCAGGTGCAGGGGGTAGG - Intronic
1076379042 10:130012541-130012563 AGGGATCAGGGGCATGAGGTGGG + Intergenic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076864725 10:133160970-133160992 GAGGTTCAGGAGCGGGGGGTGGG + Intronic
1077019144 11:409806-409828 CAGCCTGAGGGGCAGGAGGTGGG + Intronic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077233639 11:1469629-1469651 CAGGAGCAGGAGCAGGTGCAGGG + Intronic
1077235561 11:1480556-1480578 CAGCAACAGGTGCAGGAGCTCGG + Intronic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1078622700 11:12923538-12923560 CCGGATGCGGAGCAGGGGGTTGG + Intronic
1078733879 11:14002025-14002047 CATGATCAGGCACAGGAGGGAGG + Intronic
1078849495 11:15151092-15151114 CAGGCTAAGGACCAGGAGTTGGG - Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079827889 11:25221074-25221096 CAAGAGCAGGAGCAAGAGATAGG - Intergenic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1081587663 11:44398398-44398420 CAAGCCCAAGAGCAGGAGGTCGG - Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081912641 11:46709838-46709860 CAGGTTCAGTGACAGGAGGTAGG + Intergenic
1082009552 11:47441166-47441188 CAGGATCTGGCCGAGGAGGTGGG - Exonic
1082790467 11:57343250-57343272 AAGGAGGAGGAGGAGGAGGTAGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083097177 11:60263590-60263612 CAGGATCAGCACCAAGAGCTTGG + Intergenic
1083309567 11:61777447-61777469 AAGGAACACGTGCAGGAGGTGGG + Exonic
1083731520 11:64654936-64654958 TAGGATCCTGAGCAGGAAGTAGG + Intronic
1083747396 11:64743662-64743684 CAGGGTCAGGAGCCGGGGATAGG - Intronic
1084095332 11:66907573-66907595 CAAGCTGAGGGGCAGGAGGTAGG - Intronic
1084155784 11:67311765-67311787 CAGGAGCAGGAGCAGGGGCAGGG + Exonic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084714602 11:70865603-70865625 CAGGCTCAGCAGCAGAGGGTGGG + Intronic
1084718605 11:70889780-70889802 CAGGACCAGGACCAGGAGTGGGG + Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085232199 11:74981925-74981947 GAGGCTAAGGAGCAAGAGGTAGG + Intergenic
1085509617 11:77081688-77081710 GAGGCTCAGGAGCTGGAGGAGGG + Intronic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1088757290 11:112896314-112896336 CAGGAGCAGGAGTGGGAGGTGGG - Intergenic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1088889462 11:114033214-114033236 CAGGGTCAGAATCAGGATGTGGG - Intergenic
1089633462 11:119797502-119797524 CAGCCTCAGGATCAGGAGCTTGG - Intergenic
1089666137 11:120021203-120021225 CAGGAGCAGGAGGAGGGGTTGGG - Intergenic
1089915159 11:122147548-122147570 CAGGTGCTGGAGCAGGAGATAGG + Intergenic
1090402844 11:126460097-126460119 GAGGAGCGGGAGCAGGAGGAGGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090938385 11:131365664-131365686 CATGAGGAGGAGGAGGAGGTGGG - Intergenic
1091234993 11:134015661-134015683 CTGGAGCAGGAGCCTGAGGTGGG + Intergenic
1091387276 12:103332-103354 GGGGCTCAGGAGAAGGAGGTGGG + Intronic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091705339 12:2689630-2689652 CAGGCTGTGGTGCAGGAGGTGGG + Intronic
1091863295 12:3806205-3806227 CAGGACCAGGCGCAGGGGTTTGG + Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092136054 12:6148024-6148046 CAGGATCAGGAATAGGCAGTGGG - Intergenic
1092597244 12:10021057-10021079 CTGGAGCAGGAGCAGGAGAGAGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094746550 12:33350923-33350945 CAGTAGCAGGAGCAAGGGGTGGG + Intergenic
1096056906 12:48660847-48660869 CAGGATCCTGAAAAGGAGGTTGG - Intronic
1096072352 12:48782415-48782437 TGGGAGGAGGAGCAGGAGGTGGG - Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096575806 12:52552219-52552241 GCGGATCAGGAGCAGCAGGAAGG - Intronic
1096878824 12:54650782-54650804 CAGGAGGAGGAGCAGGTGATGGG - Intergenic
1097107093 12:56632390-56632412 TAAGATTGGGAGCAGGAGGTAGG - Intronic
1097797674 12:63880973-63880995 CCGGATCAGGAGTAGGGGGAGGG + Intronic
1099429619 12:82566807-82566829 CAGGCTCAGGAGCAAGAGTGAGG - Intergenic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1100278038 12:93090002-93090024 CGGAAGCAGGAGCAGGAGTTGGG - Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1101997586 12:109535955-109535977 CAGGTGCAGGAGCATGAGGTGGG - Exonic
1102177095 12:110884093-110884115 CAGCTTCAGCAGCCGGAGGTGGG - Exonic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102251659 12:111391462-111391484 CAGGGTCAGGAGCTGAAGGGAGG + Intergenic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1102420794 12:112801280-112801302 CAGCATTTGGAGCAGGAGCTGGG + Intronic
1102571956 12:113832127-113832149 CATGACCAGGAGCTGGAGATAGG + Intronic
1102621782 12:114201901-114201923 TAGGAGCAGGATCAGGAGTTAGG + Intergenic
1102897918 12:116613297-116613319 CAGGGTCAGTGCCAGGAGGTGGG + Intergenic
1102966934 12:117135148-117135170 CAGGAGCAGAGGCAGGAGGGAGG - Intergenic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1105019687 12:132807883-132807905 CAGCATCTGCAGCAGGTGGTGGG - Exonic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1109052820 13:57506624-57506646 CCAGATCATCAGCAGGAGGTGGG - Intergenic
1109423834 13:62147092-62147114 CAAGAACAGGAGCAAGGGGTGGG + Intergenic
1109564844 13:64098777-64098799 CAGAATCAGGAGCAGGACTTGGG - Intergenic
1109989222 13:70031637-70031659 CAGGATCCTGAGCAGGATGGGGG + Intronic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1112012005 13:95300937-95300959 GGGGAGGAGGAGCAGGAGGTGGG - Intronic
1112627658 13:101123941-101123963 CAAGATTGGGAGCTGGAGGTAGG - Intronic
1113001173 13:105639104-105639126 CAGGAGCAGGAGCAAGAGTAGGG - Intergenic
1113464571 13:110504384-110504406 CCAGATTAGGAGCAGGAGGGTGG - Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1115266005 14:31500854-31500876 CAGGATCAGTCTCAGGAGATAGG + Intronic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115460115 14:33650862-33650884 CAGGAGCAGGAGCAGGACCCAGG + Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1117760509 14:59022373-59022395 CAGAATTAGGATCAGCAGGTCGG + Intergenic
1117881593 14:60318049-60318071 CAAGGTAAGGAGCAGAAGGTGGG - Intergenic
1118302218 14:64625943-64625965 CTGGATCTGGAGCAGGAGGGAGG + Intergenic
1118484014 14:66196864-66196886 CAGGCCCAGGAGTAGCAGGTAGG + Intergenic
1118898787 14:69969449-69969471 CAGGAGCAGGAACAGGAGAGAGG + Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119181018 14:72605289-72605311 CAGGAGCAGGAGGAGGGGATGGG + Intergenic
1119426538 14:74539023-74539045 CATTATGAGGAGCAGAAGGTGGG + Intronic
1119640820 14:76313566-76313588 CAGGCTCAGGTGCAGGAAGAGGG + Intronic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1122128580 14:99592405-99592427 CAAGGCCAGGAGCAAGAGGTAGG + Intronic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122360335 14:101156247-101156269 CAGTATCAATAGCAGGGGGTAGG - Intergenic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1122668820 14:103354320-103354342 CAGGAGCGGGAGCAGGAGAGTGG - Intergenic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123183204 14:106489209-106489231 CTGGGTCAGGCACAGGAGGTGGG - Intergenic
1202927147 14_KI270724v1_random:37036-37058 CATGATCAGGAGCAGTAGATGGG - Intergenic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1123681982 15:22770101-22770123 CAGGAGCAGGAGGAGCAGATGGG - Intergenic
1124588068 15:31028349-31028371 CAGGTTCACCAGCAGGATGTTGG + Exonic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125672031 15:41480694-41480716 CAGGGTCAGAAGCAGCAGGCTGG - Exonic
1125738848 15:41947319-41947341 CAGGGTGGGGAACAGGAGGTAGG + Intronic
1127992789 15:64133151-64133173 CAGGCTCATAAGCATGAGGTAGG - Intronic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128240272 15:66096751-66096773 TAGGATCGGGAGCAGGGGGCAGG - Intronic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128726815 15:69994049-69994071 TAGGAACAACAGCAGGAGGTGGG + Intergenic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129136383 15:73555967-73555989 CAGGACCAGGTGCTGGAGGGTGG - Intronic
1129697818 15:77750566-77750588 CAGAAGCAGGCCCAGGAGGTGGG - Intronic
1131214051 15:90522227-90522249 CAGGATTGGGAGCAGCAGCTGGG - Intergenic
1131261525 15:90890398-90890420 CAGGAGCAGGAGCGAGAGGGGGG + Exonic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132549438 16:548304-548326 GAGGCTCAGGAGCAGGAAGAGGG - Intronic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133759279 16:8785475-8785497 CAGTGTAAGGAGCAGGACGTGGG + Intronic
1134060005 16:11193696-11193718 CAGGATGAGGAGGAAGAGGGAGG - Intergenic
1135303640 16:21350936-21350958 CAAGGTCAGGTGCAGGAGTTGGG + Intergenic
1135336587 16:21606632-21606654 CAGGATGGGGACCAGGATGTGGG - Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1136025318 16:27464802-27464824 CAGCATCAGGTGCTGGAGGTCGG - Exonic
1136246375 16:28978535-28978557 CATGAACAGGACCAGGAAGTTGG - Intronic
1136300385 16:29330131-29330153 CAAGGTCAGGTGCAGGAGTTGGG + Intergenic
1136735523 16:32462914-32462936 CAGGGTCAGGGTCAGGAGTTAGG + Intergenic
1136841543 16:33545942-33545964 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1137291583 16:47055377-47055399 CAGGAGCAGGGACAGGAGGCTGG + Intergenic
1137745535 16:50817490-50817512 CTGGATTAGCGGCAGGAGGTGGG + Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1139375773 16:66495457-66495479 AAGGATCAAGGGCAGGAGGGAGG - Intronic
1139375798 16:66495544-66495566 AAGGATCAAGGGCAGGAGGGAGG - Intronic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139964304 16:70737060-70737082 CAGGCTCAGGAGGAGGAGATGGG + Intronic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1142221406 16:88856764-88856786 CATGAGCAGGAGCAGGATGTTGG + Exonic
1203151708 16_KI270728v1_random:1846239-1846261 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1142889541 17:2933842-2933864 CCGGATCAGGACCAGGAGCTCGG + Intronic
1143021762 17:3920425-3920447 CAGGATTGGGAGCTGGCGGTGGG - Intergenic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1143181354 17:4986334-4986356 CAGGATGAGAAGTATGAGGTAGG + Intronic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143381180 17:6497426-6497448 CAGGACCAGGGGCTGGAGTTAGG + Intronic
1143403446 17:6660472-6660494 CAGGCTAAGGAGCATGAAGTGGG + Intergenic
1143524328 17:7463394-7463416 CAGGCTCAGGGGGAGGAGGTGGG + Exonic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1144227442 17:13163390-13163412 CTGGAGCAGGAGCAAGAGATGGG + Intergenic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1144605662 17:16663417-16663439 AAGGCACAGGAGGAGGAGGTGGG + Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144832551 17:18139800-18139822 CAGGATCAGGATGAGGCGCTAGG - Intronic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145077311 17:19867103-19867125 GAGGATCAGCAGCAGCCGGTCGG + Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1146675846 17:34773360-34773382 CAGGATGAGGAGCTGAGGGTGGG + Intergenic
1147562657 17:41518645-41518667 CAGGGTCAGGAGGAGGATATGGG - Exonic
1147769376 17:42857027-42857049 CAGGAGGAGGAGGAGGAAGTAGG - Exonic
1148104473 17:45112126-45112148 CAGGTTCCGGAGCTGGAGGGAGG + Exonic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148142610 17:45339154-45339176 CAGACTCAGGAGCCTGAGGTGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148800474 17:50221866-50221888 CAGAACCAGGACCAGGAGATAGG - Intergenic
1149066423 17:52485921-52485943 CAGGAGGAGGAGGAGGAGATGGG - Intergenic
1149891431 17:60392824-60392846 CATGGTCAGGAGGAGAAGGTGGG - Intronic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150238399 17:63611696-63611718 CAGGCTCTGACGCAGGAGGTGGG - Intergenic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151509472 17:74549504-74549526 CAGGACCAGGAGCAGGACGTAGG + Intergenic
1151513921 17:74580074-74580096 GAGGAACAGGAACAGGAAGTGGG + Exonic
1151556905 17:74851311-74851333 CAGGGGCAGGACCAGGAGATAGG + Intronic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1151943840 17:77308690-77308712 CAGGATCAGAAGCAGGCTTTGGG - Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152337759 17:79707833-79707855 CAGGGTCAGGAGCATGACTTTGG + Intergenic
1152637298 17:81435365-81435387 CAGTAGCAGGGGCAGGATGTGGG + Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1153468464 18:5416022-5416044 CAAGCTCTGGGGCAGGAGGTTGG + Exonic
1153741799 18:8137687-8137709 CAGGGTCTGGAGCAGGGGCTGGG - Intronic
1154032520 18:10766224-10766246 GAGGAACAGGAGGAGGAGGAGGG + Intronic
1155248383 18:23932974-23932996 CAGGGATTGGAGCAGGAGGTGGG + Intronic
1155688810 18:28590496-28590518 CAGGATGAGGGGCAAGAGATGGG - Intergenic
1156748455 18:40421006-40421028 CAGGAACAGAGGCAGGAGGCTGG - Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157424313 18:47571835-47571857 TAGGATCTGGAGCAGGGGGAAGG + Intergenic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1157519206 18:48333969-48333991 TAGGATCAGGAGGTGCAGGTGGG - Intronic
1158389020 18:57028061-57028083 CAGGATCTGTAGCAGTAGATAGG - Exonic
1158722195 18:59935434-59935456 CAGCATTAGGAGCAGGATGAAGG - Intergenic
1159040535 18:63319906-63319928 CAGGACCAGGAGGAGGAGAAAGG - Exonic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159691249 18:71491063-71491085 GTGAATCAGGAGCAGGAGATGGG + Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160033162 18:75279558-75279580 GAGGAGCTGGAGCAGGAGGACGG + Intronic
1160143650 18:76347559-76347581 GAGGAGCAGGTGCAGGAGGAGGG - Intergenic
1160397535 18:78583395-78583417 CAAGGTCAGGAGCACGAGGCTGG - Intergenic
1160563243 18:79771900-79771922 AAGGCTCAGGAACAGGAGGGAGG - Intergenic
1160720703 19:595851-595873 GAGGATTAGGGGCCGGAGGTCGG - Intronic
1160799802 19:962493-962515 AAGGATCAGCAGCAGAGGGTTGG - Intronic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161771014 19:6230666-6230688 CAGGTTCAGGAACAGGTCGTAGG + Exonic
1161815726 19:6498732-6498754 CAGGCTCGGGAGGAGGAGGGAGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1162018553 19:7858314-7858336 CAGCTACAGGAGCAGCAGGTAGG + Exonic
1162740577 19:12771392-12771414 CTGGATCTGGAGCGGCAGGTAGG - Exonic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163013538 19:14440312-14440334 TCGGAGCAGGAGCTGGAGGTGGG + Exonic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163769257 19:19180723-19180745 CAGGATCAGGCTGAGGAGGGCGG + Exonic
1163779639 19:19239663-19239685 CAGGATGAGGAGCAGAAAGGAGG - Intronic
1163779755 19:19240069-19240091 GAGGATGAGGAGCAGGAGGGAGG - Intronic
1164324425 19:24179474-24179496 GAGGAAGAGGAGCAGGAGGATGG + Intergenic
1164740403 19:30571640-30571662 GAGAAGCAGGAGCAGGAAGTGGG - Intronic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165423742 19:35734455-35734477 AAGGATCGGGAGCGGGAGGTGGG + Intronic
1165486883 19:36101716-36101738 CAGGGTCAGGAGGCGGAGCTGGG - Exonic
1165545142 19:36528811-36528833 CAGGATCAGGAGGAGGTTGGAGG + Intergenic
1165934914 19:39383450-39383472 GAAGATCAGGAGCTGGAGGGAGG - Intronic
1166368987 19:42291143-42291165 CGGGCTCAGGAGCAGGTGCTGGG + Exonic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1166859604 19:45802155-45802177 GAGGAGGTGGAGCAGGAGGTTGG - Exonic
1166871323 19:45872764-45872786 CAGGCTCAGGGGCTGGAGGCGGG - Exonic
1167110379 19:47457263-47457285 AAGGATCTGGAGCAGCTGGTGGG - Exonic
1167264653 19:48477669-48477691 CAGGACCAGGTGCAGGAGAAGGG - Intronic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167528711 19:50001542-50001564 GGGGGTAAGGAGCAGGAGGTGGG - Intronic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168238319 19:55077042-55077064 CAGGATGAGGAACAGGAGTTTGG + Intronic
1202677676 1_KI270711v1_random:22386-22408 CAGCATCAAGAGCAGGGAGTAGG - Intergenic
925507437 2:4584164-4584186 GAGGTGGAGGAGCAGGAGGTGGG - Intergenic
925736635 2:6969473-6969495 CAGGAGCATGAGCAGGGTGTGGG - Intronic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926188324 2:10708808-10708830 CAGGACCAGGAGGAGGTGATGGG + Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927908795 2:26881587-26881609 CAGGAGCAGGCACAGGAGGAAGG + Intronic
928607860 2:32960676-32960698 CAGGAGCTGGAACTGGAGGTGGG + Intronic
928704494 2:33933342-33933364 CAAGATCATGAGCAGGATCTTGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929785549 2:44988264-44988286 CAGGATCAGGAGTGAGGGGTGGG + Intergenic
930066556 2:47332303-47332325 GAGGGTGAGGAGTAGGAGGTGGG + Intergenic
931429676 2:62197867-62197889 AAGAACCAGGAGCAGGAGTTAGG - Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
935179135 2:100674838-100674860 CAGGCTTAGAAACAGGAGGTGGG - Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
935396486 2:102615096-102615118 CAGTATCTGGAGCAGGATGTAGG + Intergenic
935580333 2:104750660-104750682 CAGGACCAGGGGCAGGAGCAAGG + Intergenic
936521045 2:113212420-113212442 CGTGTTCAGGAGCAGGAGCTCGG + Intergenic
937258348 2:120570142-120570164 CAGCAGCCTGAGCAGGAGGTGGG - Intergenic
937904204 2:127044940-127044962 TAGGATCTGGAGCTGGAGGTGGG - Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938548944 2:132361715-132361737 CAGCCTCAGGCGCAGGAGGGAGG - Intergenic
938552322 2:132393618-132393640 GGTGATCAGGAGCATGAGGTGGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940259425 2:151764999-151765021 GAGGATGGGGAGCAGGAGGGAGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940847038 2:158652721-158652743 CAGGAGCTGGGGCAGGAGGTGGG + Intronic
941439409 2:165514700-165514722 AAGGAGCAGGAGGAGGAGTTGGG - Intronic
942951728 2:181729196-181729218 CATGATCAGCCGGAGGAGGTAGG - Intergenic
943521017 2:188949403-188949425 CGGGATGAGGAGCTGGAAGTGGG - Intergenic
943687060 2:190829755-190829777 TAGGAGCAGGAGCAAGAGGGTGG + Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
946195673 2:218032070-218032092 CAGCCTCAGGAGCAAGAGGTTGG - Intergenic
946211451 2:218150461-218150483 CAGCACCAGGAGCAGGAAGGTGG - Intergenic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947542305 2:230987457-230987479 CAGAATCAGGAGCAGGATCAGGG + Intergenic
947718390 2:232352939-232352961 CTGGATCAGGAGCTGGGGGAAGG - Intergenic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948354710 2:237368819-237368841 CAGGACCAGGACCAGGTGTTGGG + Exonic
948590008 2:239043214-239043236 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
948604335 2:239125313-239125335 CAAGAGCAGGAGCAAGGGGTGGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168766925 20:388163-388185 CACGATCTGGAGCAGTAGGTGGG - Exonic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169425630 20:5495145-5495167 CAGGAGGAGGAGCAGCAGGGAGG + Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1169929326 20:10815582-10815604 AGGGATCAGAAGCAGGAGATTGG + Intergenic
1170470483 20:16663622-16663644 CACTACCAGGAGCAGGTGGTTGG + Intergenic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1171377306 20:24702432-24702454 CAGGGGCAGGAGCAGGGGATGGG + Intergenic
1171781426 20:29422138-29422160 CACGATCAGGAGCAGTAGATAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172297607 20:33824407-33824429 CAGGTTGAGGAGCACAAGGTTGG + Intronic
1172443880 20:34983178-34983200 CAGGACCAGGAGCAGGGACTGGG - Intronic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173153393 20:40587078-40587100 GTGGATCAGGAGCTGGAGGTCGG - Intergenic
1173617663 20:44413599-44413621 GAGGAGTGGGAGCAGGAGGTGGG - Intronic
1173800845 20:45893405-45893427 CAGGTTTATGAGCAGCAGGTGGG + Intronic
1174406629 20:50307038-50307060 CAGGCTCAGGAGCTGGGAGTGGG + Intergenic
1174589637 20:51634994-51635016 CAGCATGAGTACCAGGAGGTGGG - Intronic
1174799356 20:53550244-53550266 CGGGAGCAGGAGCAAGAGTTGGG + Intergenic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175505518 20:59481694-59481716 CAGGCTCAGGAAAAGGAGGGGGG + Intergenic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175855535 20:62118907-62118929 CAGGATCTGGCGCAGGAGAGGGG - Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176183277 20:63763506-63763528 CAGGAGCAGGAGCAAGACGGAGG + Intronic
1176726802 21:10442657-10442679 CAGGAGCTGGAGTGGGAGGTAGG - Intergenic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1177009102 21:15709841-15709863 CAGGATCCTGAGAATGAGGTTGG - Intergenic
1177151931 21:17463999-17464021 GAGGATCAGCAACAGAAGGTAGG - Intergenic
1177855467 21:26395686-26395708 CAGGAACTGGATCAGGTGGTGGG + Intergenic
1178433629 21:32537737-32537759 TAGGATCAGGAGAAGAAGGGAGG + Intergenic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179070256 21:38064464-38064486 CAAAGCCAGGAGCAGGAGGTGGG - Intronic
1179150651 21:38805879-38805901 CAGGAGCGGGAGGAGGAGGGAGG - Intronic
1179464606 21:41563241-41563263 GAGGATGAAGAACAGGAGGTGGG - Intergenic
1179799320 21:43803549-43803571 GAGGAAGAGGAGCAGGAGGAGGG + Exonic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180662890 22:17484299-17484321 CAGGATCAGGAGGCTGAGGCAGG - Intronic
1180743132 22:18067593-18067615 CAAGGGCAGGAGCAGGAGGTGGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181113166 22:20613618-20613640 CATGGTCAGAAGCAGGAGGTGGG + Intergenic
1181583807 22:23842174-23842196 AAGGAGCCGGTGCAGGAGGTCGG + Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181755069 22:25018016-25018038 GAGGAGGAGGAGGAGGAGGTTGG - Intronic
1181941841 22:26483807-26483829 CAGGAGCTGGAGGGGGAGGTAGG - Exonic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183380288 22:37487272-37487294 CAGGGTGAGTAGCAGGAGATGGG - Intergenic
1184205348 22:42998956-42998978 CAGGATGGGGAGCTGGAGATGGG - Intronic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184511898 22:44938778-44938800 CAGGATCAGGAACAGGTTCTGGG + Intronic
1185207855 22:49550370-49550392 CAGGCACAGGAGGAGCAGGTGGG - Intronic
1185391650 22:50564670-50564692 CCTGCTCAGGAGCTGGAGGTGGG + Intergenic
949254651 3:2031085-2031107 TAGGATGAGGAGCTGGTGGTAGG + Intergenic
949415319 3:3807674-3807696 CAGGATCAGGAGTGAGAGTTAGG + Intronic
949556424 3:5157378-5157400 CAGGCTCAGGACCAGGAAGTGGG - Intronic
949559023 3:5186116-5186138 CAGGATCAAGGGCTGGAGCTGGG + Intergenic
949928336 3:9059249-9059271 GAGGAGCAGGAGCAGTGGGTTGG - Intronic
950176010 3:10874986-10875008 GAGGATCAGCAGCATGATGTAGG - Exonic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
951306851 3:21074385-21074407 CAGGAGCAGGAGCAAGAGAGAGG + Intergenic
954440755 3:50520843-50520865 CAGGGCCTGGAGCAGGATGTAGG - Intergenic
954798207 3:53172213-53172235 CAGCAAGAGGAACAGGAGGTGGG - Intronic
954870430 3:53763608-53763630 GAGCATCAGGGGCAGGGGGTGGG - Intronic
954924998 3:54226292-54226314 AAGCATCAGGGGCAGGAGGCGGG - Intronic
954990111 3:54833375-54833397 AAGGGGTAGGAGCAGGAGGTGGG - Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
957914298 3:86666991-86667013 CAGGAGCAGGAGCAAGGAGTGGG - Intergenic
958931634 3:100213819-100213841 CAACAACAGAAGCAGGAGGTTGG + Intergenic
959191721 3:103121049-103121071 CAGATTCAGAAGCAGGAGGATGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960657467 3:120021546-120021568 TAGGAACAGGAACAGGAGTTTGG + Intronic
960764932 3:121115822-121115844 CAGGAGCAAGAGGAGGAGTTAGG + Intronic
960865468 3:122194997-122195019 GAGGAGGAGGAGCAGGAAGTAGG - Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961372584 3:126440630-126440652 CAGGAGCAGGGGCAGGGGGAGGG - Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961641357 3:128366536-128366558 GAGGAGGAGGAGCAGGAGCTGGG + Intronic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
963262938 3:143211100-143211122 CAAGACCAGGAGCAAGAGGTTGG + Intergenic
963867565 3:150379032-150379054 CTGGAGCAGGAGCAAGAGATGGG - Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
967923921 3:194632145-194632167 CAATATCAGCACCAGGAGGTAGG - Intronic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968652197 4:1764730-1764752 CAGGAACAGGAACAGAGGGTGGG - Intergenic
968809233 4:2792683-2792705 CAGGATCAGGACCACGGGGCTGG + Intergenic
968811495 4:2801470-2801492 CAGGCCCAGGAGCAAGAGGGAGG - Intronic
968877496 4:3280684-3280706 AAGGATCAGGATCAGGAACTTGG + Intergenic
969583682 4:8080033-8080055 CAGGGCCAGGAGCTGGGGGTCGG - Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970920221 4:21385302-21385324 CAGAACCACCAGCAGGAGGTGGG + Intronic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
973956458 4:56068105-56068127 AAGGATCAGGCATAGGAGGTTGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
976508520 4:85880027-85880049 ATGGATCAGTACCAGGAGGTTGG + Intronic
976783502 4:88789439-88789461 AAGGATCAGGTGTAGGAGGTGGG - Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977934399 4:102784780-102784802 GAGGAGGAGGAGGAGGAGGTTGG - Intergenic
978237933 4:106482604-106482626 GAGGAGCGGGAGAAGGAGGTGGG - Intergenic
978480518 4:109184933-109184955 CAGAATCAGGATCAAGAGATGGG - Intronic
979279309 4:118847323-118847345 CAGCCTCAGGAACAGGAGGAAGG - Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983938426 4:173518785-173518807 CAGGAGCAGGTTCAGGAGCTGGG + Intergenic
984788635 4:183592884-183592906 CAGCAACACGACCAGGAGGTGGG + Intergenic
984797062 4:183671462-183671484 CAGAAGCAGGAGCAGCAGTTGGG - Intronic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
985515726 5:343751-343773 CACGAGGAGGAGCAGGAGGTGGG + Intronic
985722388 5:1496553-1496575 CAGGTTCAGGGGCAGGAGAGAGG + Intronic
986279239 5:6309969-6309991 AATGAACAGGAGAAGGAGGTGGG - Intergenic
987300174 5:16590165-16590187 CAGGATCAGCAGCTGGGGTTGGG - Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
990280929 5:54250141-54250163 CAGGAGTGGGAGCAAGAGGTGGG + Intronic
991029055 5:62063576-62063598 CAGTAGCAAGAACAGGAGGTAGG + Intergenic
991340134 5:65600046-65600068 CAGGAGCAGGAGCAAGAGAGAGG + Intronic
991435958 5:66597001-66597023 GAGGAGCAGGACGAGGAGGTGGG + Exonic
992666415 5:79013767-79013789 CAGGAGCAGGAGCAAGAGACAGG + Intronic
992912335 5:81408164-81408186 GAGGAGGAGGAGGAGGAGGTGGG + Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993885373 5:93409608-93409630 CAGTATCACGACCAGGAGTTTGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994097467 5:95859943-95859965 CAGCATCAGAAGCAGGGCGTTGG - Exonic
994732478 5:103509082-103509104 GAGACTCAGAAGCAGGAGGTTGG + Intergenic
994840721 5:104922210-104922232 CAAGAACAGGAGCAAGAGGAGGG - Intergenic
996000956 5:118362960-118362982 TAGAACCAGGAGCAGGAAGTAGG - Intergenic
996979312 5:129471057-129471079 CAGGATCAAAATCAGGCGGTGGG + Intronic
997238262 5:132288100-132288122 CAGGAACTGGAGCATGATGTCGG + Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997732628 5:136192342-136192364 CAGGAAGAAGAGCAGCAGGTAGG + Intergenic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998787273 5:145726605-145726627 TAGGACCAGGATCAGGAAGTTGG + Intronic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
1000039197 5:157472536-157472558 CAGGATGAGGGACAGGATGTAGG - Exonic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001607568 5:172973229-172973251 CATGATCAAGAGCAGGAACTAGG + Intergenic
1001825203 5:174739289-174739311 CAGGATCAGGAACAGCAGGATGG + Intergenic
1002560253 5:180076845-180076867 AAGGGGCAGGAGCAGGAGGTGGG - Intergenic
1002660061 5:180785725-180785747 CAGGATCAGGAGTAGGTGAGCGG - Intergenic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1003398529 6:5773141-5773163 CAGGAGCAGGACCAAGAGGGTGG - Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005868017 6:29951103-29951125 TATGATCAGGAGCAGATGGTGGG - Intergenic
1005883016 6:30074714-30074736 GAGGAGCGGGAGCAGGAGGCTGG - Intronic
1005926238 6:30447989-30448011 CAGGAGGAGGAGCAAGCGGTGGG + Intergenic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006445613 6:34078204-34078226 GAGGAACAGGAGCTGGAGATGGG - Intronic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007384789 6:41513147-41513169 CAGGCACTGGAGCTGGAGGTGGG + Intergenic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1008104491 6:47427668-47427690 CTGGAGCAGGAGCAAGATGTGGG + Intergenic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1011398737 6:86937464-86937486 GAGGAGCAGGAGCAGGAGCATGG - Exonic
1011493941 6:87920525-87920547 TAGGATCAGGGCCAGGAGGAAGG - Intergenic
1011514961 6:88144228-88144250 CAGGATCAGGACCAGGGTCTTGG + Exonic
1011751684 6:90460710-90460732 GGGGATCCGGAGCAGGAGGTAGG - Intergenic
1012321101 6:97846983-97847005 GGGGATCAGGAGCAGGAAGTGGG + Intergenic
1013033821 6:106361109-106361131 AAGGAGGAGGAGGAGGAGGTGGG - Intergenic
1014214115 6:118736511-118736533 CAGGGTCTGAATCAGGAGGTAGG + Intergenic
1014506838 6:122269649-122269671 CAGGAGCAGGAGCAAGAGAGGGG + Intergenic
1014551730 6:122796830-122796852 CAGGTACAGGAACATGAGGTGGG - Exonic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015693715 6:135956402-135956424 GAGCATCAGCAGCAGAAGGTGGG + Intronic
1015759534 6:136644009-136644031 CATGTCCAGGAGCAGGAGGTGGG + Intronic
1015961845 6:138658352-138658374 CAGGAGCTGGAGTGGGAGGTAGG - Intronic
1017006605 6:150032093-150032115 AAGGATCCTTAGCAGGAGGTGGG - Intergenic
1017006780 6:150033151-150033173 CGAGAGCAAGAGCAGGAGGTTGG + Intergenic
1017007687 6:150039640-150039662 CAGGAGGAGGGACAGGAGGTGGG - Intergenic
1017812883 6:157996769-157996791 CAGGAGCAGGACCAAGAGGGTGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018790195 6:167142378-167142400 CAGGAGCAGGTGCAGGCGCTGGG - Intergenic
1018847463 6:167565576-167565598 CAGGATGAGGGGCAGGCGGGTGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019705518 7:2495564-2495586 CAGGGCCAGGAGCAGCACGTGGG + Intergenic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1019969601 7:4529567-4529589 CAGGAGCAGGAGCAAGAGAAAGG + Intergenic
1020006311 7:4785305-4785327 CAGGACCGGGAGCAGGGGGGTGG - Intronic
1020343195 7:7134766-7134788 TAGGATGAGGAGGAGGATGTTGG + Intergenic
1020392588 7:7674506-7674528 CAGGGACAGGAGCAGTAGCTGGG + Intronic
1020408514 7:7865020-7865042 CAAGATCAGGGGAAGGAGTTTGG - Intronic
1020555913 7:9670157-9670179 GAGGAGGAGGAGGAGGAGGTTGG + Intergenic
1020748672 7:12111801-12111823 AGGGATCAGAAGCAGGAGGCAGG - Intergenic
1020937377 7:14484506-14484528 CAATAGCAGGAGCAAGAGGTGGG - Intronic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1022103713 7:27184119-27184141 CAGGCTGGGGAGCCGGAGGTGGG - Intronic
1022441272 7:30435489-30435511 CAGGTACAGGAGGAGGAAGTGGG - Intronic
1022470162 7:30677092-30677114 CAAGATGAGGTGCAGGAGGAGGG + Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023689773 7:42773741-42773763 CAAGATCAGAAGCATGAAGTGGG - Intergenic
1023995552 7:45157368-45157390 CAGGCTCAGGGGCAGAGGGTGGG - Intergenic
1024204209 7:47141615-47141637 CAGTATCAGGGGCAGGAAGAGGG - Intergenic
1024212103 7:47215261-47215283 CAAGATCTGGGGCAGGAGGCTGG - Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1025149690 7:56538907-56538929 CGAGCTGAGGAGCAGGAGGTGGG - Intergenic
1025189893 7:56888403-56888425 CACCACCAGGAGTAGGAGGTAGG - Intergenic
1025682046 7:63688518-63688540 CACCACCAGGAGTAGGAGGTAGG + Intergenic
1026294172 7:69036604-69036626 CAGGAGGAGGAGAAGCAGGTTGG + Intergenic
1026381849 7:69808031-69808053 CAGGATCCGGAGGCTGAGGTAGG - Intronic
1026479032 7:70763072-70763094 CAGGGTCCGGAGAAGGAGCTCGG - Exonic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028747717 7:94346726-94346748 GAGGCACAGAAGCAGGAGGTGGG + Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029160045 7:98545023-98545045 AATGATCAGCAGTAGGAGGTGGG + Intergenic
1030320750 7:108164573-108164595 GAGGAGCAGGAGCAGGAGCAGGG + Intronic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1031429647 7:121651330-121651352 CTGGAGCAGGAGCAAGGGGTAGG - Intergenic
1031874486 7:127122972-127122994 CAGGAACAGGAGAAGAAGATGGG + Intronic
1032834774 7:135662572-135662594 CAGGAACTGGAGCATGATGTCGG - Exonic
1033492367 7:141855796-141855818 CAGCCACAGGAGCAGGAGCTAGG - Intergenic
1033600012 7:142882587-142882609 CAGGAACATGAGCTGGAGGGAGG - Intronic
1033629184 7:143140279-143140301 AAGGATCAGGTGCACGAAGTGGG + Intergenic
1033953759 7:146817650-146817672 CAGGAACAAGAGCAAGAGGAAGG + Intronic
1034603311 7:152285297-152285319 CAGGAGCTGGAGTGGGAGGTAGG + Intronic
1034835495 7:154348085-154348107 CAGCATCAGGAGGTGGGGGTGGG - Intronic
1034889010 7:154822775-154822797 CAGGATGAAGAGCAGGAAATAGG - Intronic
1034973817 7:155436470-155436492 AGGGAGCAGGAGCAGGAGTTCGG - Intergenic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035095725 7:156353381-156353403 CAGGAACTGGAGCAGGAGTGGGG - Intergenic
1035109706 7:156470927-156470949 CGGGAGCAGGAGCAGGAGAGCGG - Intergenic
1035128439 7:156628540-156628562 CCAGAGCAGGAGCAAGAGGTGGG - Intergenic
1035850670 8:2916156-2916178 GAGGCTGAGCAGCAGGAGGTAGG - Intergenic
1035864872 8:3071050-3071072 CCAGAACAGGAGCAAGAGGTGGG + Intronic
1036155390 8:6337459-6337481 CAGGAATAGGAGCAGGATGAAGG - Intergenic
1036502799 8:9328994-9329016 CAGGATCAGTGGGAAGAGGTAGG - Intergenic
1037319884 8:17632153-17632175 AAGGATCGGGAGGAGGAGGGAGG - Intronic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1037763430 8:21757043-21757065 TAGGGCCAGGAGCTGGAGGTTGG - Intronic
1037792810 8:21961711-21961733 CAGGATCAGTGGCAGGATCTTGG + Intronic
1038430877 8:27498330-27498352 CAGGAAGAGGAGCTGGAGCTAGG + Intronic
1038523535 8:28253897-28253919 CCGGACCAAGAGCAAGAGGTTGG + Intergenic
1039307380 8:36277484-36277506 CAGGATCATGAGCTGGGGGCAGG - Intergenic
1039600576 8:38833590-38833612 CAGCATCCTGAGCAGGCGGTAGG - Intronic
1040522910 8:48193234-48193256 GAGGAGGAGGAGCAGGAGCTGGG + Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1045040452 8:98219042-98219064 CAGGATCAGGGGTAGGAGTGAGG + Intronic
1045555194 8:103208759-103208781 CAGGATCAAGAGCAGGCAGCAGG - Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046444981 8:114306670-114306692 CAGGATGAGGAGGAAGAGCTGGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1049356294 8:142190187-142190209 CCCCATCAGGAGCAGGAAGTCGG - Intergenic
1049408350 8:142461582-142461604 CAGGAGCAGGCACAGGAGCTGGG - Intronic
1049419338 8:142510107-142510129 GAAGAACAGGAGGAGGAGGTTGG + Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049719815 8:144110612-144110634 CAGGGTCAGGAACCGGAGCTGGG - Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1050441719 9:5670948-5670970 CAGGACCAGGACCAGTTGGTGGG + Intronic
1051297402 9:15611120-15611142 CCAGATCAGGAGCAGGAGGAAGG - Intronic
1051509434 9:17861142-17861164 CAGGATCAGCGTCAGGAGATGGG - Intergenic
1052193545 9:25684766-25684788 CAAAAGCAGGAGCAAGAGGTGGG - Intergenic
1053410236 9:37911594-37911616 CAGGGTCAGGGGCTGGAGCTGGG - Intronic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053751954 9:41266195-41266217 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054257477 9:62830525-62830547 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054302958 9:63391084-63391106 CAGGATCAGGGTCAGGAGCAGGG - Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1055275907 9:74615401-74615423 CTGGCTCAGGCGCAGAAGGTGGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057325858 9:94062606-94062628 TGGGAGCAGGAGCAGGAGGAAGG + Intronic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1059235293 9:112755520-112755542 CAGGGTCTTGAGCAGGAGGGGGG + Intronic
1060140031 9:121201688-121201710 CAGGACCAGGAACAGGAGTGCGG + Exonic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1061153927 9:128845760-128845782 AAAGAAGAGGAGCAGGAGGTGGG + Intronic
1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG + Intergenic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1061613785 9:131765944-131765966 CAGGGCTGGGAGCAGGAGGTCGG - Intergenic
1061967595 9:134025104-134025126 GAGGAGCAGGAGGAGGAGCTGGG - Intergenic
1062189835 9:135242319-135242341 CATGCTCTGGAGGAGGAGGTGGG - Intergenic
1062192170 9:135253633-135253655 CAGGAAGAGGAGCATGAGGGCGG - Intergenic
1062260399 9:135659815-135659837 CATGGTCAGGAGCACGTGGTAGG - Intergenic
1062307211 9:135914755-135914777 CACGATCATGAGAGGGAGGTAGG + Intergenic
1062340261 9:136090947-136090969 CAGGCACAGGGGCAGGAGCTGGG + Intronic
1062354535 9:136155526-136155548 CAGTTTGAGGAGCAGGAGCTGGG - Intergenic
1062405786 9:136395598-136395620 CAGAACCGGGAGCAGCAGGTGGG - Exonic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1203441179 Un_GL000219v1:9995-10017 CATGATCAAGAGCAGTAGATAGG + Intergenic
1203511988 Un_KI270741v1:128903-128925 CATGATCAAGAGCAGTAGATAGG + Intergenic
1185463147 X:341515-341537 CAGGAGGAGGGGCAGGAGGGGGG - Intronic
1185892484 X:3833741-3833763 CAGGTTCTGGAGCAGGTGGCGGG - Intronic
1185897592 X:3872160-3872182 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1185902711 X:3910592-3910614 CAGGTTCTGGAGCAGGTGGCGGG - Intergenic
1186051270 X:5598251-5598273 CAAGAGCAGGAGCAAGAGATGGG + Intergenic
1186679908 X:11862001-11862023 CTGGAGCAGGAGCAAGGGGTTGG + Intergenic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189263921 X:39699305-39699327 CAGGAGCAGGACCAGGAGATGGG + Intergenic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1190128241 X:47724400-47724422 CAAGGTCAGGGGCAGGATGTGGG + Intergenic
1190252141 X:48735165-48735187 CAAGATCAGGAGGCTGAGGTGGG + Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192362930 X:70450494-70450516 GAGGAGCAGAGGCAGGAGGTAGG - Intronic
1195477164 X:105300354-105300376 CAGGAGCAGGAGCAAGAGAGAGG + Intronic
1196410263 X:115411195-115411217 GAGGGTCAGCATCAGGAGGTTGG + Intergenic
1197896212 X:131318245-131318267 TAGGATCAGGAACAGGGGGAAGG - Intronic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1198957477 X:142148583-142148605 GAGGAGGAGGAGCAGGAGCTTGG + Intergenic
1199271294 X:145885600-145885622 CCGTAACAGGAGCAGGGGGTGGG - Intergenic
1200259098 X:154602462-154602484 CGGGGGCAGTAGCAGGAGGTGGG + Intergenic
1201190395 Y:11438827-11438849 CAGGACCAGGGTCAGGAGGAGGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic