ID: 1145217448

View in Genome Browser
Species Human (GRCh38)
Location 17:21062529-21062551
Sequence TCTTGTCTATGTCTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145217448_1145217449 -6 Left 1145217448 17:21062529-21062551 CCAGCAGGAAGACATAGACAAGA No data
Right 1145217449 17:21062546-21062568 ACAAGACAAAAGACGATATGAGG No data
1145217448_1145217452 21 Left 1145217448 17:21062529-21062551 CCAGCAGGAAGACATAGACAAGA No data
Right 1145217452 17:21062573-21062595 GGGAATTTTATAATCAGTAATGG No data
1145217448_1145217454 28 Left 1145217448 17:21062529-21062551 CCAGCAGGAAGACATAGACAAGA No data
Right 1145217454 17:21062580-21062602 TTATAATCAGTAATGGGAAACGG No data
1145217448_1145217450 0 Left 1145217448 17:21062529-21062551 CCAGCAGGAAGACATAGACAAGA No data
Right 1145217450 17:21062552-21062574 CAAAAGACGATATGAGGAAAAGG No data
1145217448_1145217453 22 Left 1145217448 17:21062529-21062551 CCAGCAGGAAGACATAGACAAGA No data
Right 1145217453 17:21062574-21062596 GGAATTTTATAATCAGTAATGGG No data
1145217448_1145217451 1 Left 1145217448 17:21062529-21062551 CCAGCAGGAAGACATAGACAAGA No data
Right 1145217451 17:21062553-21062575 AAAAGACGATATGAGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145217448 Original CRISPR TCTTGTCTATGTCTTCCTGC TGG (reversed) Intergenic