ID: 1145219464

View in Genome Browser
Species Human (GRCh38)
Location 17:21076293-21076315
Sequence GAAGTCAAAGAGATACAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145219464_1145219471 -2 Left 1145219464 17:21076293-21076315 CCATGCTGTATCTCTTTGACTTC No data
Right 1145219471 17:21076314-21076336 TCTGGATGGGTGGGGAACTGAGG No data
1145219464_1145219470 -10 Left 1145219464 17:21076293-21076315 CCATGCTGTATCTCTTTGACTTC No data
Right 1145219470 17:21076306-21076328 CTTTGACTTCTGGATGGGTGGGG No data
1145219464_1145219472 13 Left 1145219464 17:21076293-21076315 CCATGCTGTATCTCTTTGACTTC No data
Right 1145219472 17:21076329-21076351 AACTGAGGAATAAATTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145219464 Original CRISPR GAAGTCAAAGAGATACAGCA TGG (reversed) Intergenic
No off target data available for this crispr