ID: 1145219959

View in Genome Browser
Species Human (GRCh38)
Location 17:21080174-21080196
Sequence TTCGTGGCTCTCAGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145219959_1145219963 22 Left 1145219959 17:21080174-21080196 CCTTCAGAGCTGAGAGCCACGAA No data
Right 1145219963 17:21080219-21080241 TTGACAGCAAGACAGTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145219959 Original CRISPR TTCGTGGCTCTCAGCTCTGA AGG (reversed) Intergenic