ID: 1145228073

View in Genome Browser
Species Human (GRCh38)
Location 17:21147856-21147878
Sequence GCTCAGCAACACAACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145228071_1145228073 5 Left 1145228071 17:21147828-21147850 CCAAAGGAGATGGCAAATCATAA 0: 1
1: 0
2: 7
3: 53
4: 266
Right 1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG 0: 1
1: 0
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145228073 Original CRISPR GCTCAGCAACACAACACTGT AGG Intronic
903984606 1:27217088-27217110 TCTCACAAACATAACACTGTAGG - Intergenic
904331786 1:29762917-29762939 GCTCAGGAAGACTAAACTGTGGG + Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
916307600 1:163356681-163356703 TCTCAGTAACACCACTCTGTTGG + Intergenic
916457118 1:164982476-164982498 GCTCTGAAACCCATCACTGTTGG - Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
920517301 1:206595318-206595340 GCTTGGCAACACAAAATTGTGGG - Intronic
921146356 1:212361593-212361615 GCTCTGTATCACCACACTGTGGG - Exonic
922029369 1:221783124-221783146 GCACAACAACCCAACACAGTAGG - Intergenic
924391736 1:243567699-243567721 GCTCAGCAAAACAACGTTTTAGG - Intronic
1065159177 10:22901272-22901294 GCACAGCACCAGAAAACTGTTGG - Intergenic
1065315092 10:24456427-24456449 GCTCAGTGACACAACAATGATGG + Intronic
1068143668 10:53038255-53038277 GCTCACAAACACTACACTCTGGG - Intergenic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1070791581 10:79192675-79192697 GCTCAGCTCCTCAACACAGTGGG + Intronic
1071015188 10:80988627-80988649 GCTAAGCCACACAACAGAGTGGG - Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074577899 10:114687975-114687997 GCTCAGCTATACAACTTTGTTGG + Intergenic
1075056397 10:119222058-119222080 GATCATCAGCACAACCCTGTGGG + Intronic
1078136812 11:8658512-8658534 GCTCATCACAACAACAGTGTTGG + Intronic
1078464817 11:11542209-11542231 GCAAAGCAAAACAAAACTGTGGG + Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1089012599 11:115143145-115143167 GCTCACCCACAAAACACTTTGGG - Intergenic
1089750169 11:120645886-120645908 GCTCAGCAACAAAACCCGGCAGG - Intronic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092735717 12:11580611-11580633 GCTCAGTAGCAAAACTCTGTGGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093163159 12:15773000-15773022 GCTCAGCATCAGACCACAGTGGG + Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101449322 12:104762043-104762065 GCTCATTAACAAAAGACTGTAGG + Intergenic
1102354305 12:112219955-112219977 GCCCAGCATCACAACAATGAGGG + Intronic
1102390323 12:112544391-112544413 GCTCATAATCCCAACACTGTGGG - Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115976953 14:39007257-39007279 GTTAAGAAACAGAACACTGTAGG - Intergenic
1117833267 14:59776115-59776137 GCTCAGCAACATCATAATGTTGG - Intronic
1119754447 14:77105156-77105178 TTTGAGAAACACAACACTGTGGG + Intronic
1119966350 14:78920655-78920677 GGTCAGCTGCACAAAACTGTGGG - Intronic
1121294856 14:92811435-92811457 GCTCAGCCAAACAACATAGTAGG - Intronic
1124256205 15:28144944-28144966 GCACAGTGACACAACACTCTTGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1130302749 15:82692420-82692442 GCTCAGCCGCACTGCACTGTGGG + Intronic
1130882671 15:88068722-88068744 GCTCAGCAACTCAGGACAGTAGG + Intronic
1132413222 15:101601468-101601490 GCCCAGCAAGTCAACACAGTGGG - Intergenic
1132532217 16:458078-458100 GCTCAGGAATTCCACACTGTGGG + Intronic
1137755985 16:50902641-50902663 GGTCAGCAACACCACCCAGTGGG - Intergenic
1138728242 16:59164579-59164601 GCTCAGTACCAGAATACTGTAGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1140730404 16:77851079-77851101 GCACAGAAACACCAAACTGTGGG + Intronic
1140899027 16:79351262-79351284 GTTCAGCAACACACCTCTCTGGG - Intergenic
1143642230 17:8205583-8205605 GCCCAGCAACTCCACACTGAAGG + Intronic
1144396112 17:14844705-14844727 ACTCAGCAATACAAAACTGATGG - Intergenic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1151897891 17:76992601-76992623 CATCAGCAACATAACACGGTGGG + Intergenic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157816223 18:50731016-50731038 GCTCTCCAACACATCTCTGTAGG - Exonic
1158250111 18:55478502-55478524 GTTCAGCTACTCAAAACTGTTGG + Intronic
1159367969 18:67494296-67494318 GCCCTGCAACACTACACTTTGGG - Intergenic
1160813084 19:1021403-1021425 GTTCTGCAACATACCACTGTAGG + Intergenic
1164708426 19:30337252-30337274 GCTCAGCAACCCCACTCTGTGGG - Intronic
1165732798 19:38157330-38157352 TCTCAGGAACACAACAGGGTGGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
925570740 2:5310116-5310138 GCTTTGCAACACAAAAATGTAGG - Intergenic
926767831 2:16337920-16337942 GTTAAGCAACACATGACTGTAGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927888812 2:26735539-26735561 GATCATCAGAACAACACTGTGGG + Intergenic
930749084 2:54915241-54915263 ACACCCCAACACAACACTGTTGG - Intronic
931649447 2:64454647-64454669 GCTCAGCACCCCAGCACTGCTGG - Intronic
932933163 2:76066873-76066895 GCTCAGCAACACAAAGCATTAGG + Intergenic
934553158 2:95274453-95274475 GCTCAGGAACCCAAACCTGTCGG + Exonic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
947475554 2:230444744-230444766 GCTCAGCACCACATGCCTGTGGG + Intronic
1168920086 20:1525273-1525295 GCTCTTCATCACAACACTATTGG - Intergenic
1168933847 20:1646294-1646316 GGCCAGAAACAAAACACTGTAGG + Intronic
1170349918 20:15427652-15427674 GCTCATCAGTACAACACTGAAGG - Intronic
1170432993 20:16294416-16294438 GCTCAGCAACACCCCTTTGTTGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171132112 20:22663532-22663554 GCTCAGCAAGGCAACACTAAGGG - Intergenic
1173700738 20:45069171-45069193 GCTAAGCAACACATCAGTCTTGG - Intronic
1173813425 20:45970139-45970161 CCCCAGCACCACACCACTGTGGG + Intronic
1176669897 21:9723403-9723425 GCTCAGCAAGAAAATGCTGTTGG + Intergenic
1181767152 22:25100146-25100168 GCTCTGCCCCACACCACTGTGGG - Intronic
1181957282 22:26597133-26597155 GCTCAGCAAAACCACAGGGTGGG + Intergenic
1181970119 22:26683552-26683574 GCTCAGAGACACAGCACTGGAGG - Intergenic
1183598814 22:38828296-38828318 GCTCAGCCACACGACCCTGCAGG + Exonic
951811143 3:26701461-26701483 CTCCAGCAACACAAAACTGTAGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954303296 3:49712741-49712763 GCCCAGCAACACACTTCTGTGGG + Intronic
958729439 3:97945916-97945938 CATCAACAACACAACACTGAAGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
967152652 3:186663990-186664012 TCTCAGCAGAACAGCACTGTAGG + Intronic
968444649 4:644828-644850 GCTGAACTAAACAACACTGTGGG - Intronic
969240469 4:5893682-5893704 GCTCAGCAAAATAAAACTGACGG - Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
981826722 4:148951115-148951137 CCTCTGTAACACAAAACTGTGGG - Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
985404885 4:189628128-189628150 GCTCAGCAAGAAAATGCTGTTGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
994153074 5:96472534-96472556 TCTTTGCAACACAACACTCTAGG + Intergenic
994208240 5:97059820-97059842 CCTCTGCAACACAACACCATTGG - Intergenic
994426484 5:99594763-99594785 ACTCACCTACACAACTCTGTAGG - Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995587506 5:113663417-113663439 GCTCATGAAAACAACAGTGTGGG + Intergenic
996444812 5:123534896-123534918 GCTGAACAACACAACACACTTGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000075386 5:157779843-157779865 GCTCATCACCACACCACAGTTGG + Intergenic
1001579450 5:172789057-172789079 GCTCAGCAGCTCAGCCCTGTGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1005944200 6:30583861-30583883 ACACAGCAACACATCAATGTTGG - Exonic
1010258816 6:73791424-73791446 TCCCAGCATCCCAACACTGTGGG - Intronic
1014970588 6:127810383-127810405 AATCACCAACACAACATTGTTGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1020016406 7:4834482-4834504 GCTCAGCAGCACAGCACCGTGGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022996732 7:35763764-35763786 TCTCAGCAACATAATACTGAAGG - Intergenic
1023406473 7:39838606-39838628 GGTCAGCAATTCAGCACTGTTGG - Intergenic
1027603046 7:80263343-80263365 GTTCAACAAGACGACACTGTGGG + Intergenic
1027784271 7:82559621-82559643 GCTTGGCAACACAACACAGACGG + Intergenic
1029935412 7:104419794-104419816 GCTCAGGAACATCACACTGAAGG + Intronic
1031249490 7:119361953-119361975 GTTCAGGAACAAATCACTGTGGG - Intergenic
1033156811 7:138964057-138964079 GCACCACCACACAACACTGTAGG + Intronic
1034373500 7:150623276-150623298 GCTTGGCAACAGTACACTGTAGG + Intergenic
1036099595 8:5764198-5764220 GATAACCAACACAATACTGTAGG + Intergenic
1036508203 8:9375655-9375677 GCTCAGAAACAAACCAATGTAGG + Intergenic
1044144609 8:88696299-88696321 GTTCGGCAACACTACACTGCAGG - Intergenic
1045630403 8:104113190-104113212 GCTCATAAACAAAACACTGGGGG + Intronic
1047064526 8:121265637-121265659 CAGCAGCAACACCACACTGTGGG + Intergenic
1048133538 8:131723295-131723317 GTTCAGCTAAACTACACTGTTGG + Intergenic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1194597828 X:95880833-95880855 GCTCAGCATCACAAATCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1199133283 X:144220052-144220074 GCCCAGCAATGCCACACTGTGGG - Intergenic
1199787571 X:151118637-151118659 CTTCCCCAACACAACACTGTTGG - Intergenic
1200949836 Y:8885904-8885926 GCTCACCAAAAGAATACTGTCGG + Intergenic
1202163787 Y:21965039-21965061 GCTCACCAAAAGAATACTGTCGG - Intergenic
1202227569 Y:22621325-22621347 GCTCACCAAAAGAATACTGTCGG + Intergenic
1202315555 Y:23574329-23574351 GCTCACCAAAAGAATACTGTCGG - Intergenic
1202555213 Y:26095745-26095767 GCTCACCAAAAGAATACTGTCGG + Intergenic