ID: 1145228788

View in Genome Browser
Species Human (GRCh38)
Location 17:21154800-21154822
Sequence GAATGACAGCAACAGTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145228788 Original CRISPR GAATGACAGCAACAGTGTAA GGG Intronic
904577924 1:31517411-31517433 GAATCACAGCACAAGTGAAATGG + Intergenic
909883418 1:80909532-80909554 GAATGACAGCAAAGTTATAAAGG + Intergenic
910173412 1:84402015-84402037 GAATGACACCAAGAGTGTTTTGG + Exonic
910625151 1:89298717-89298739 GAATATCATCAACAGTGGAATGG - Intergenic
911577337 1:99594063-99594085 GAAAGGCAGCAGCAGTGTAAAGG + Intergenic
912255086 1:108050194-108050216 CAATGAAATGAACAGTGTAAAGG - Intergenic
912673983 1:111659907-111659929 GAATGACAGCAATGTTATAAGGG - Intronic
913686981 1:121241475-121241497 GGATGAAATCAACATTGTAAAGG + Intronic
914038840 1:144029115-144029137 GGATGAAATCAACATTGTAAAGG + Intergenic
914150613 1:145038814-145038836 GGATGAAATCAACATTGTAAAGG - Intronic
914688320 1:150002587-150002609 GAATGACACAAACACTGAAATGG + Intronic
916885146 1:169060154-169060176 GAAGGCCAGCTGCAGTGTAAAGG - Intergenic
918510489 1:185308069-185308091 GAAAGACAGCAACTATATAAGGG + Intronic
920474310 1:206259994-206260016 GGATGAAATCAACATTGTAAAGG + Intronic
921093625 1:211867262-211867284 GAATGACAGCAATGATGCAAAGG - Intergenic
922181599 1:223239673-223239695 GAATGACAGCAATGGTACAAGGG - Intronic
923184632 1:231559040-231559062 GTATGGCAGCAACAGTGTTGGGG - Intronic
923926632 1:238636005-238636027 AAATCACAGCAACAGTGTTTGGG + Intergenic
924140416 1:241017130-241017152 GAATGACAGCAATGCTGCAAGGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063826389 10:9903274-9903296 ATATGTCAGTAACAGTGTAATGG - Intergenic
1068048886 10:51923674-51923696 GAATGACAGCAACCTTATAAGGG - Intronic
1068313212 10:55306362-55306384 GATTGATAGGAACTGTGTAAGGG - Intronic
1068761264 10:60712325-60712347 GAATGACAGCAATATTATAAGGG + Intronic
1068963916 10:62892940-62892962 GAAAGACAGCGACAGAGAAATGG + Intronic
1069097523 10:64277613-64277635 GAATGCCAGCAAAAGTGTAGTGG - Intergenic
1069340011 10:67398754-67398776 TCATGAAAGCAACAGTGTAGAGG - Intronic
1069908440 10:71745834-71745856 GAATGGCTGCCACAGTCTAATGG + Intronic
1071132363 10:82409759-82409781 GTTTGACTGCAACAGTGTGAGGG - Intronic
1071174796 10:82913267-82913289 GAATGACAGCAATGTTATAAGGG - Intronic
1072299756 10:94047829-94047851 GAATGACAGAAACAGAATTAAGG - Intronic
1072714498 10:97741147-97741169 CACTGCCACCAACAGTGTAAAGG - Intronic
1074036648 10:109745869-109745891 GAAAGAAAGAAACAGAGTAAAGG - Intergenic
1075495835 10:122917662-122917684 GATTTGCAGGAACAGTGTAAAGG + Intergenic
1078613448 11:12842304-12842326 GGGAAACAGCAACAGTGTAAGGG - Intronic
1080206671 11:29737231-29737253 GAAAGACAGGAACATTATAAAGG - Intergenic
1080286728 11:30623525-30623547 GAATGAAAGCAATGGTATAAGGG - Intergenic
1080321554 11:31015811-31015833 GGATGTCAGCCACTGTGTAAAGG + Intronic
1080756971 11:35210154-35210176 GATTAAAAGTAACAGTGTAACGG - Intronic
1083095765 11:60249382-60249404 CACTCCCAGCAACAGTGTAAAGG + Intergenic
1084030379 11:66477498-66477520 GAAGGAAAGCAACACTGTGATGG - Intergenic
1085464687 11:76715818-76715840 GAATGACAGCACCTGAGAAATGG + Intergenic
1085592178 11:77774247-77774269 GAATGAAAGCAACAGGGAGAGGG + Intronic
1086158528 11:83695194-83695216 GAGAGTCAGCAGCAGTGTAATGG + Intronic
1086922498 11:92603215-92603237 GAATAGCAGCCACAGTGTAGAGG - Intronic
1087353572 11:97064433-97064455 GCATCACATCAACAGAGTAAAGG + Intergenic
1087674468 11:101143765-101143787 GAATGAGAGAAACAGTTTATTGG + Intergenic
1090073686 11:123565415-123565437 ATAGGACAGCAACAGTGTCATGG - Intronic
1091012036 11:132010374-132010396 GGATGACAGATACAGTCTAAAGG + Intronic
1091125855 11:133096173-133096195 GAATGATAGCAACAATACAATGG + Intronic
1092697367 12:11188171-11188193 GTATGACAGCAACATTAAAAAGG - Intergenic
1093322541 12:17731355-17731377 AATTGAGAGCAACAGTCTAATGG + Intergenic
1093924098 12:24891411-24891433 CACTGACAGCAACCGTGTGACGG + Intronic
1097095964 12:56548477-56548499 GAATGACTGAAATAGTGCAAAGG + Intronic
1097680553 12:62645225-62645247 GAATGACAGCCACAGGGAGATGG - Exonic
1098427494 12:70381735-70381757 GAATGACAGCTAAAGGGTACAGG + Intronic
1099160349 12:79233619-79233641 GAATGACAGCAGCTGTAGAAAGG - Intronic
1099595887 12:84665705-84665727 GATTGACAGCATGAGTTTAAGGG + Intergenic
1100133117 12:91520832-91520854 CAATCCCACCAACAGTGTAAAGG - Intergenic
1101864481 12:108510322-108510344 AAAAGACATCAACAGTGCAATGG - Intergenic
1102535399 12:113577014-113577036 GAGTGACAGGAACAGAGAAAGGG - Intergenic
1102634556 12:114311763-114311785 GAAAGCCAACAAGAGTGTAAGGG - Intergenic
1108061197 13:46535055-46535077 GAAAGACAGCAATTGTGTGATGG + Intergenic
1108946776 13:56036335-56036357 GAATGAAAGCCACAGAGGAATGG - Intergenic
1111155748 13:84322183-84322205 TAATGACATCAACAGTATTAAGG + Intergenic
1112615313 13:100998527-100998549 GAATGATAGCACCAGTGTTACGG + Intergenic
1113617129 13:111688796-111688818 GAAACTCAGCAACAGTGTAGGGG + Intergenic
1113622659 13:111774067-111774089 GAAACTCAGCAACAGTGTAGGGG + Intergenic
1115406079 14:33018341-33018363 GAAGGTCAGCAAAAATGTAAAGG - Intronic
1116298883 14:43150651-43150673 AAATGTCAGCAACAATGAAAGGG - Intergenic
1116315550 14:43386763-43386785 GAATTATAGCAACAGTGAAAAGG + Intergenic
1116730252 14:48612218-48612240 GAGTCCCACCAACAGTGTAAAGG - Intergenic
1117534575 14:56691377-56691399 CACTGGCAGCATCAGTGTAACGG - Intronic
1117717815 14:58598907-58598929 TAATGACAGGAATAGTGAAATGG + Intergenic
1118825429 14:69376021-69376043 GTATGACAACAATAGTGTAAAGG - Intergenic
1119534033 14:75385689-75385711 GAATGACAGCAATGTTATAAGGG + Intergenic
1120017941 14:79495808-79495830 GAATAACACCATCATTGTAAAGG - Intronic
1120387394 14:83863536-83863558 GATTGACATCAATAGTGTAGGGG - Intergenic
1120424677 14:84332141-84332163 GAATGACAGCTGAACTGTAATGG + Intergenic
1120666176 14:87309281-87309303 GAGAGACAGCAACAGTAGAATGG - Intergenic
1121715479 14:96070906-96070928 TAATGACTGCCACACTGTAAAGG + Intronic
1121760245 14:96438928-96438950 GGATGACAGAAACATAGTAAAGG + Intronic
1123111587 14:105870808-105870830 CAATCCCAGCAACAGTGTATGGG + Intergenic
1202842797 14_GL000009v2_random:138554-138576 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1202912194 14_GL000194v1_random:128796-128818 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1123887181 15:24738123-24738145 GAATGACAGAAATAATATAAAGG + Intergenic
1125203096 15:37119626-37119648 AAATAACAGTAACAGAGTAAAGG - Intergenic
1127059469 15:55167371-55167393 GAATCATAGCAAGAGTGTGAAGG + Intergenic
1127702576 15:61515256-61515278 GAATGAGACCAAGAGTATAAGGG + Intergenic
1128850164 15:70946697-70946719 TATTGACAGCAACAATGTACAGG + Intronic
1130699112 15:86161271-86161293 CAATGACAGCTATATTGTAACGG - Intronic
1131580384 15:93637072-93637094 CAATCCCACCAACAGTGTAAAGG + Intergenic
1131711646 15:95062285-95062307 GCTTGCCAGCAACAGTGTAGTGG + Intergenic
1133978024 16:10614045-10614067 GAATGGCAGCAACATTATAAAGG + Intergenic
1134141279 16:11721705-11721727 CACTGTCAGCCACAGTGTAATGG + Intronic
1135857004 16:26021004-26021026 GCATGACAGGAACTGTGGAAAGG - Intronic
1137849003 16:51719833-51719855 AAAAGACAGCAACTCTGTAAGGG + Intergenic
1137896423 16:52217553-52217575 GAAAGACAACAACAGTGAGAAGG + Intergenic
1139195662 16:64915761-64915783 GAATAACAGCATCAGGGTAAGGG + Intergenic
1140246670 16:73256159-73256181 GAATGACAGCAAAATTGTTTTGG - Intergenic
1143451314 17:7038459-7038481 GGGTGAGGGCAACAGTGTAACGG - Exonic
1143985834 17:10913183-10913205 GAAAGACAGCTACAGTTTGATGG + Intergenic
1145033494 17:19523533-19523555 GAATGACAGCAACCATAGAAAGG - Intronic
1145228788 17:21154800-21154822 GAATGACAGCAACAGTGTAAGGG + Intronic
1146463864 17:33070168-33070190 AAATGACAGCAATATCGTAAAGG - Intronic
1147856013 17:43480598-43480620 GAATGACAGTAACAGTTGAGTGG + Intergenic
1148145532 17:45362221-45362243 CAGTGACAGCAACACTGGAAAGG + Intergenic
1148809633 17:50282035-50282057 GAATGACAGAAACAGTGAGCTGG + Intergenic
1151428349 17:74045912-74045934 GAATGGCAGCGAAAGTGTCAAGG + Intergenic
1153204932 18:2689020-2689042 GAAAAACAGTAACAGGGTAATGG + Intronic
1153466268 18:5391102-5391124 GATTGCAAGCTACAGTGTAAGGG + Intergenic
1155058351 18:22205254-22205276 TAGTGACATCAACTGTGTAATGG - Intergenic
1156066056 18:33144395-33144417 AAATGTCAGCAACATTATAATGG + Intronic
1156689420 18:39688717-39688739 AAATGACAACAATAGTGAAAAGG + Intergenic
1157728679 18:49985342-49985364 GGATGACAGCAAACATGTAAGGG - Intronic
1157905066 18:51562508-51562530 GAAACACAGGAACAGTGTCATGG + Intergenic
1158695899 18:59703565-59703587 GAAAGTTTGCAACAGTGTAAGGG + Intergenic
1161278624 19:3433363-3433385 GAATGACAGCTCCAGTCTGATGG - Intronic
1164790752 19:30978244-30978266 GAATGACAGTAATGTTGTAAGGG - Intergenic
1165584430 19:36901364-36901386 GAATAACAGCTAGAGTGTACAGG + Intronic
1165729904 19:38138540-38138562 GAATGACAGCAAACATGGAAAGG - Intronic
927458864 2:23280298-23280320 GAATTACAGCAACATGGCAATGG + Intergenic
927599137 2:24424986-24425008 GAATGACATCAACAATGAACTGG - Intergenic
929601569 2:43207795-43207817 GCATAACAGCATCAGGGTAAAGG + Intergenic
929631106 2:43462995-43463017 AAAGGACAGCAACAGTTTGAGGG + Intronic
929772125 2:44901134-44901156 GAGTGACAGCTATAGGGTAATGG - Intergenic
929847730 2:45548665-45548687 TAATCACAGCAACATAGTAAAGG + Intronic
932645771 2:73499915-73499937 CAATCACAGCAGAAGTGTAAGGG - Intronic
933113516 2:78435477-78435499 GATTGATAGCAATACTGTAAGGG + Intergenic
933399447 2:81775179-81775201 GTATGACAGCAATGTTGTAAGGG - Intergenic
934477858 2:94604828-94604850 GAATGACAGAAACAGAATGAGGG + Intergenic
935409734 2:102748328-102748350 CAATGACAGCAGCAGTGAGAGGG - Intronic
935903523 2:107818097-107818119 TAATGACAGCCACAGTGCTATGG + Intergenic
936289821 2:111214427-111214449 GAATGACAACAATAATATAAAGG - Intergenic
939321767 2:140632339-140632361 GAATGACAGCAATGTTTTAAGGG + Intronic
939441164 2:142251748-142251770 GAAAGACAGCAATATTGTAAGGG + Intergenic
940246816 2:151628043-151628065 GTCTAACAGCAACAGTCTAATGG + Intronic
940372108 2:152914760-152914782 GAGTGACAGCAATAATGCAAGGG - Intergenic
941116373 2:161477154-161477176 GGATGACAGCCACATTGTAGTGG - Intronic
943926244 2:193784483-193784505 GAATGACAGCAATAATACAAGGG + Intergenic
944026193 2:195171195-195171217 AAATGACAGCAACAGTATTTGGG - Intergenic
944603198 2:201324385-201324407 GATAGACAGCAACACAGTAATGG + Intronic
945630494 2:212269192-212269214 GAATCACAGCAACATTAAAAGGG - Intronic
946055618 2:216899328-216899350 GAGTGACAGCAACGTTGTAAGGG - Intergenic
947239697 2:227980679-227980701 TAATGACAGAAGCAGGGTAATGG - Exonic
948776674 2:240292720-240292742 TAATCACAGCCACAGTCTAAGGG - Intergenic
1169098646 20:2926372-2926394 GAATGCCATCTACAATGTAAGGG - Intronic
1169294388 20:4381060-4381082 GAATGAAAACAATGGTGTAATGG - Intergenic
1171003359 20:21437909-21437931 GGATGACAGAAACATTCTAATGG - Intergenic
1171070902 20:22067634-22067656 AAAGGACAGCAACAGTGTAGAGG - Intergenic
1171071059 20:22069055-22069077 AAAGGACAGCAACAATGTAGAGG + Intergenic
1171153511 20:22849101-22849123 GAATAACAGCAACATTATAATGG + Intergenic
1172656968 20:36543341-36543363 GAATGACTTCAACAGAGTCATGG + Intronic
1174376979 20:50132796-50132818 CAATGACAGCAACAGTAATATGG - Intronic
1176631551 21:9143473-9143495 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1177830320 21:26131509-26131531 TAGAGACAACAACAGTGTAATGG + Intronic
1184888572 22:47365238-47365260 GAATGACAGCAATTTTATAAGGG - Intergenic
1185078626 22:48696687-48696709 CAAGGACAGCAACAGTGGTATGG - Intronic
1185220200 22:49625464-49625486 GAATGACACCAAAGTTGTAAGGG + Intronic
949243925 3:1903181-1903203 GAAAGACAGAAACGGTTTAAAGG + Intergenic
949780245 3:7678531-7678553 GAATGACATTAAAAGTCTAAAGG + Intronic
949908274 3:8877778-8877800 GAAGGACAGGAAGAGTGGAAAGG + Exonic
950493725 3:13321406-13321428 GAGAGACAGCAACAGTGCTATGG + Intronic
950601424 3:14038701-14038723 AATGGACAGCAATAGTGTAATGG + Intronic
951150142 3:19278606-19278628 TTATGAGAGAAACAGTGTAAAGG - Intronic
951321139 3:21247454-21247476 GAATGACACCAATTCTGTAAGGG - Intergenic
954585475 3:51732013-51732035 GAATGACAGCAATAATACAAGGG - Intergenic
955226707 3:57066248-57066270 GAAAGAAAGGAAAAGTGTAATGG - Intronic
956145027 3:66183522-66183544 CAATGTCAGCATCAGGGTAAGGG - Intronic
956234716 3:67056559-67056581 GAATGACAGCAATAATGCATGGG - Intergenic
957098382 3:75799271-75799293 CAAGGACAGCAACTTTGTAAAGG + Intergenic
958111019 3:89145804-89145826 GAAATAAAGCAACAGTGAAATGG - Intronic
959925558 3:111917509-111917531 GAATGCCTGTAACAGTGAAATGG - Intronic
960426364 3:117512599-117512621 GGATGAGAACAACAGTGAAATGG + Intergenic
960461048 3:117936377-117936399 GAATGTCAGCATCAGAGCAATGG + Intergenic
961325805 3:126108582-126108604 CAGTGACAGCAGCAGTGCAATGG + Intronic
963085630 3:141433385-141433407 CAATGACTGTAAGAGTGTAAGGG - Intronic
963303840 3:143627733-143627755 AAATGACAGCAACAATGAAAAGG - Intronic
965503163 3:169480456-169480478 GAATGGCAGCCACAGGGGAAGGG - Intronic
966271384 3:178111105-178111127 GTAAGACAACTACAGTGTAAGGG + Intergenic
967879843 3:194293779-194293801 GAAGGACATAAACAGTGTGAAGG + Intergenic
967960685 3:194921224-194921246 TAATGACAGCAACATCATAAGGG - Intergenic
969567104 4:7985044-7985066 GAAGGACAGCAACAGTGGCTTGG + Intronic
970751992 4:19374949-19374971 AAATGAAAGCAGGAGTGTAATGG + Intergenic
970861112 4:20703606-20703628 GAAAAAAAGCAACTGTGTAAGGG + Intronic
972823397 4:42728484-42728506 GAATAATATCAACAATGTAAAGG - Intergenic
974789273 4:66665121-66665143 GAATAACAGCAGCAGAGTCATGG + Intergenic
974891209 4:67886266-67886288 GAATGACAGGAACAGTTTTCAGG + Intergenic
977376504 4:96211956-96211978 GAATGAGATCAACAGAGTAATGG + Intergenic
977481474 4:97583032-97583054 GAATCACAGTAATAATGTAAAGG - Intronic
977603039 4:98954861-98954883 TAATCACAGCAACAGTATTAAGG + Intergenic
977633334 4:99268032-99268054 GAATAACAGCACCATTTTAAAGG + Intergenic
978658072 4:111090338-111090360 AAATGACAGCAATAGTGCAAAGG + Intergenic
979141941 4:117187338-117187360 GAATCACAGGAACAGAATAATGG - Intergenic
979421030 4:120505404-120505426 CAATCACAGCAACCTTGTAAGGG - Intergenic
979795806 4:124845122-124845144 CAATGATAGAAACACTGTAAGGG - Intergenic
981832896 4:149022457-149022479 GCATGACATCAACAATGTGATGG - Intergenic
981978124 4:150756526-150756548 AAATGTAAGCAACAGTGTTATGG + Intronic
982519716 4:156399151-156399173 CACTCACACCAACAGTGTAAAGG - Intergenic
983005045 4:162474444-162474466 GAATGACAACAATATTATAAAGG - Intergenic
985645093 5:1081132-1081154 GAATGACAGAGACAGAGAAATGG + Intronic
986477400 5:8149465-8149487 GATGGACAGCCACAGTGTACAGG + Intergenic
986903008 5:12460243-12460265 ACCTGACAGCACCAGTGTAAAGG - Intergenic
986992577 5:13571228-13571250 GAAGGACAGGCACAGGGTAACGG + Intergenic
988319452 5:29673804-29673826 GTATGACAATAACAGTATAAAGG - Intergenic
988343790 5:30011461-30011483 GAAAGACAACAACAGAGAAAAGG + Intergenic
989025957 5:37068758-37068780 GAATGACTGAAACAGAGGAATGG - Intergenic
989026951 5:37078656-37078678 CACTCCCAGCAACAGTGTAAAGG + Intergenic
989247211 5:39267597-39267619 GAATGTCAGCAGCAATGTTAGGG + Intronic
990390453 5:55314477-55314499 GAAAGACAGCAACATTAGAAGGG + Intronic
992274126 5:75097265-75097287 CAGTGCCACCAACAGTGTAAAGG + Intronic
993132850 5:83921321-83921343 GAAGGAAAGCAAAACTGTAATGG + Intergenic
993963740 5:94334279-94334301 GAAAGACATAAATAGTGTAAAGG + Intronic
996233522 5:121097112-121097134 AAATGACAGCAATAATATAAGGG + Intergenic
997168540 5:131689504-131689526 GAATGACAGCAATGTTATAAGGG + Intronic
999028062 5:148258731-148258753 GAATCACAACAAAAGTGTACAGG - Intergenic
999102150 5:149035555-149035577 GAATCACAGCAACAGAGGGATGG - Intronic
999250875 5:150181602-150181624 GAATTTCAGCAAAGGTGTAAAGG - Intronic
1001365807 5:171138593-171138615 GAACGAAAGCAACAGTGAAAGGG + Intronic
1004033571 6:11898995-11899017 GAATGACAGCAATGATGCAACGG - Intergenic
1004510978 6:16284554-16284576 GGGAGACAGCAACAGTGTCAGGG - Intronic
1005168163 6:22950046-22950068 AAGTGACAGAAACAGAGTAAAGG + Intergenic
1005222544 6:23603461-23603483 GAATGAAAGCAATAATATAAGGG + Intergenic
1007101999 6:39255427-39255449 GAATGACTGCAAAAGTGCCATGG + Intergenic
1007233116 6:40364908-40364930 ATATGACAGAAACAGTTTAAAGG + Intergenic
1007355698 6:41314245-41314267 GAATGAGAACAACAGAGAAATGG + Intergenic
1007909705 6:45501263-45501285 GACTGACAGCCACAGTGTGATGG - Intronic
1008511513 6:52279986-52280008 AAATGCCATCAATAGTGTAATGG + Intronic
1010040608 6:71378520-71378542 GAATCACTGCAGTAGTGTAAGGG + Intergenic
1011943617 6:92873281-92873303 GAATGGGAGCAAAAGTATAATGG - Intergenic
1012161724 6:95893146-95893168 GAATGACAGCAATGTTATAAAGG - Intergenic
1015371869 6:132463246-132463268 GAATGATAGCAACAAAGGAATGG + Intronic
1016510514 6:144837682-144837704 GACTGAGAGCAACTGTGAAAAGG - Intronic
1017890582 6:158635308-158635330 TGATGACAGCAACACTGTGATGG - Exonic
1018277667 6:162150205-162150227 GACGGACAACAACAGTGAAAAGG + Intronic
1020571946 7:9874578-9874600 GAAGGACAGAAACATTGAAAGGG + Intergenic
1021548963 7:21849270-21849292 GAATGACAGCAATGTTATAAAGG - Intronic
1021687548 7:23202078-23202100 GAACAACAACAAAAGTGTAATGG - Intergenic
1023033839 7:36113214-36113236 GGATTAGAGCAAGAGTGTAAGGG + Intergenic
1023272486 7:38479596-38479618 GTATGACAATAACAGTGCAAAGG + Intronic
1023612625 7:41986677-41986699 GGATGACAGCAAAAGGGTATGGG + Intronic
1024094774 7:45974817-45974839 GAATGACAGCAGGAGTGAAGAGG + Intergenic
1024749141 7:52443973-52443995 GAATGACTACAACATTTTAAGGG - Intergenic
1025124551 7:56334374-56334396 GAATGGCAGAAACAGAGTACAGG - Intergenic
1026437232 7:70410167-70410189 GACTGAGAGCAACAGTGTAGTGG + Intronic
1027728080 7:81832833-81832855 TAATGACAGCAAGATTATAAGGG + Intergenic
1028154051 7:87409247-87409269 GATTGACAGCTACAGTGAAGAGG - Exonic
1028382609 7:90215275-90215297 GGATGACAGCAACTCTGAAAGGG - Intronic
1028865965 7:95712412-95712434 GAATGACAGCAATTTTTTAAGGG + Intergenic
1030149800 7:106392522-106392544 GAATGACAGACACAGGGTAACGG - Intergenic
1030368679 7:108673459-108673481 GCATAACATCATCAGTGTAACGG - Intergenic
1030890741 7:114996215-114996237 GAATCACAGCAATGGTGTCATGG - Intronic
1031731264 7:125303573-125303595 GAATCACAGCGAGAGTGTGAGGG - Intergenic
1032422700 7:131795660-131795682 GGATGACGGCATCAGTGTGAGGG - Intergenic
1033897675 7:146094651-146094673 GAAAGAGAGAAAAAGTGTAAGGG - Intergenic
1034608670 7:152344118-152344140 GACTGACAGCAACAATACAAGGG + Intronic
1036465231 8:8991295-8991317 GAAAGACAGAAACAGTAAAAGGG - Intergenic
1037004128 8:13755947-13755969 GTATGACAGCAACAGCAAAAAGG - Intergenic
1040372803 8:46794175-46794197 GAAGGAGATCAAAAGTGTAAAGG + Intergenic
1041170299 8:55135082-55135104 AAATTTCAGAAACAGTGTAATGG + Intronic
1041955057 8:63549393-63549415 TTATGACAGCAACAATGTAAAGG - Intergenic
1042315364 8:67420830-67420852 GAATGATACCTTCAGTGTAAGGG - Intergenic
1044822514 8:96164122-96164144 GAAAGACAGCATGAGTGCAAAGG - Intergenic
1044865577 8:96567939-96567961 AAATGACAGCAACACTTTGAAGG - Intronic
1045805455 8:106155511-106155533 GAATGATAGGAACTTTGTAAAGG - Intergenic
1050565674 9:6880154-6880176 GAATAAAACCAACAGAGTAACGG - Intronic
1050824225 9:9924383-9924405 TAATAACAGCAACAGAATAATGG - Intronic
1050941449 9:11464318-11464340 GAATGTTAGCGAGAGTGTAAAGG - Intergenic
1051200519 9:14616337-14616359 GATTGACAGCAAGAATATAATGG + Exonic
1051843716 9:21428047-21428069 AAATGACAGAAAAAGTGTTAAGG - Intronic
1053248849 9:36557825-36557847 AAATAACAGCACCACTGTAAGGG - Intergenic
1053680201 9:40481279-40481301 GAATGACAGAAACAGAATGAGGG - Intergenic
1053930192 9:43109589-43109611 GAATGACAGAAACAGAATGAGGG - Intergenic
1054283511 9:63143656-63143678 GAATGACAGAAACAGAATGAGGG + Intergenic
1054293281 9:63316789-63316811 GAATGACAGAAACAGAATGAGGG - Intergenic
1054391309 9:64621282-64621304 GAATGACAGAAACAGAATGAGGG - Intergenic
1054504420 9:65895045-65895067 GAATGACAGAAACAGAATGAGGG + Intergenic
1055675016 9:78649392-78649414 GAATGAAAACAAAAGAGTAAAGG + Intergenic
1055881219 9:81006277-81006299 GAAAGACAACAACATTATAAGGG + Intergenic
1056088254 9:83177890-83177912 GCATGCCAGCAACCATGTAATGG - Intergenic
1057943289 9:99303497-99303519 GAATGGCTGTAACAGTGTGATGG + Intergenic
1058248561 9:102661925-102661947 GAATGATAGCAACAAGTTAATGG + Intergenic
1058900820 9:109440657-109440679 TAATGAAACCAACAGAGTAAAGG - Intronic
1059378649 9:113906502-113906524 GAAAGAAAGCAGCAGTCTAAAGG - Intronic
1059381061 9:113925809-113925831 GAATGACAGCAATGTTATAAGGG - Intronic
1059842296 9:118231132-118231154 GACTAACAGCAACAGTTTTATGG - Intergenic
1060982269 9:127800255-127800277 GAATGACAGAAACACTGAGATGG + Intronic
1203754381 Un_GL000218v1:111077-111099 CAAGGACAGCAACTTTGTAAAGG + Intergenic
1186654833 X:11601229-11601251 GAGGGACAGCAGCAGTGTATGGG + Intronic
1188767591 X:34115084-34115106 GAATGACAGCAATGATGTAAGGG - Intergenic
1190139035 X:47825200-47825222 AAATGACAGCAACATTATAAAGG + Intergenic
1190491851 X:50990362-50990384 GAATGACAGGAACAGGGAAGCGG + Intergenic
1190510918 X:51173606-51173628 GAAAGACAGCAAGAGAGTAGGGG - Intergenic
1190631982 X:52396799-52396821 GATAGACAGCAACACAGTAATGG - Intergenic
1192420350 X:71023995-71024017 GATTGACTGCAAAAGTGTATAGG + Intergenic
1192862368 X:75089340-75089362 TAATAACAGCAACAATGTATTGG + Intronic
1194909723 X:99626534-99626556 GAATGACAGCAACATTGCAAGGG + Intergenic
1195779603 X:108447144-108447166 GAAAGACAGCTACAGTGCAGGGG - Intronic
1196213484 X:113023111-113023133 TAATGATAGCAACAGTGTATTGG + Intergenic
1196518933 X:116649572-116649594 CATTGCCACCAACAGTGTAAAGG + Intergenic
1196767504 X:119261194-119261216 TTATGACAGCAACACTGAAATGG + Intergenic
1196853138 X:119958071-119958093 GAATGACAGCAATGTTATAAAGG - Intergenic
1197012097 X:121577931-121577953 GAATGACAGCAACACTATTGGGG + Intergenic
1197023038 X:121714857-121714879 GAATGAAAGAAAAAATGTAAAGG - Intergenic
1197287984 X:124618622-124618644 GAATGATGGCAACAGGGTTATGG - Intronic
1198444828 X:136702052-136702074 TAATAATAGCAACAGTGTATTGG + Intronic
1198538514 X:137610869-137610891 GAATGACAGCAATGTTATAAGGG - Intergenic
1199739933 X:150725662-150725684 GGATGACAACAACAGCATAAAGG - Intronic
1201168011 Y:11228725-11228747 CAAAGACAGCAACTTTGTAAAGG + Intergenic