ID: 1145229764

View in Genome Browser
Species Human (GRCh38)
Location 17:21165082-21165104
Sequence GAGCGATCATCCCCATTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145229762_1145229764 -4 Left 1145229762 17:21165063-21165085 CCTATGCATTTTCCTATTGGAGC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1145229764 17:21165082-21165104 GAGCGATCATCCCCATTCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145229764 Original CRISPR GAGCGATCATCCCCATTCTG AGG Intronic