ID: 1145231157

View in Genome Browser
Species Human (GRCh38)
Location 17:21174317-21174339
Sequence TTGTCCTTGTAGAATAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145231153_1145231157 28 Left 1145231153 17:21174266-21174288 CCGTGTTTCTCCTATCTTGTCTC 0: 1
1: 0
2: 0
3: 43
4: 520
Right 1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 176
1145231154_1145231157 18 Left 1145231154 17:21174276-21174298 CCTATCTTGTCTCTTGTTTTGTG 0: 1
1: 0
2: 1
3: 47
4: 444
Right 1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145231157 Original CRISPR TTGTCCTTGTAGAATAGTGT GGG Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908480729 1:64536425-64536447 TTGTCCTTGTTCAGTAGTTTGGG + Intronic
911359638 1:96861441-96861463 TTGTTCTTTCAGAATTGTGTTGG + Intergenic
914434358 1:147647137-147647159 ATGACCCTGTAGAATTGTGTCGG - Exonic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920144450 1:203846460-203846482 ATTTCCTTGTAGACAAGTGTAGG + Intronic
920370154 1:205473631-205473653 TCCTCCTTGTAGAATACTCTGGG + Intergenic
922688320 1:227665421-227665443 TTGTCTTTGTTGAATTCTGTTGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924178087 1:241413145-241413167 TTGTCCATGAAGAATAGCTTGGG + Intergenic
1062776062 10:149016-149038 TTGAACTTGAAGAATAGAGTAGG + Intronic
1067519864 10:46991190-46991212 TTGTCCTTTTAGATCATTGTTGG + Intronic
1067642384 10:48060652-48060674 TTGTCCTTTTAGATCATTGTTGG - Intergenic
1073045072 10:100632247-100632269 GTGACTTTGTAGAATTGTGTGGG - Intergenic
1077345222 11:2045220-2045242 TGGTGCATGGAGAATAGTGTAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080257784 11:30310959-30310981 TTGTACTTGTGGAATGGGGTAGG + Intergenic
1080714177 11:34782475-34782497 TTGTCCATGTAGTATGATGTAGG + Intergenic
1080961973 11:37171419-37171441 TTTGCATTGTAGAATATTGTAGG + Intergenic
1081094359 11:38914819-38914841 TTGCCTTTGTGGAATACTGTGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088020949 11:105118269-105118291 CTGTCCTTGTAGAATAAGTTTGG - Intergenic
1089125034 11:116170878-116170900 CTGTCCTTGTAGAATACAGATGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090516287 11:127431273-127431295 TTTTGCTTGTTGAATTGTGTAGG + Intergenic
1093702557 12:22238398-22238420 TTCTCCTTGTGAATTAGTGTGGG - Intronic
1094574713 12:31674667-31674689 TTGTTCTATTAGAATGGTGTAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105886546 13:24647510-24647532 TTGTCCTTGGAGAATTCTGAAGG - Intergenic
1108008549 13:45978247-45978269 TTGTCCTTGTAGAATTTAATGGG - Intronic
1108706128 13:52989665-52989687 TTTTCTTTGTAGTCTAGTGTTGG - Intergenic
1108841230 13:54618005-54618027 TTTACCTTGTTGAATGGTGTTGG + Intergenic
1111393656 13:87633873-87633895 TTGTCCATTTAGTATAATGTTGG - Intergenic
1111420311 13:88001803-88001825 TTGGCCTTGTAGAATAAGTTAGG + Intergenic
1114904436 14:27108565-27108587 TTATGTTTGTAGAATAGAGTAGG - Intergenic
1120048584 14:79838130-79838152 TTGTCTTTGTAAAATCATGTAGG - Intronic
1123814334 15:23961487-23961509 TTTACCTTGTACATTAGTGTGGG + Intergenic
1124174512 15:27410391-27410413 TTGACCTTATAAAATATTGTGGG + Intronic
1124181887 15:27483851-27483873 TTGTCCTTGGAGAATAGCTGAGG - Intronic
1126227448 15:46287915-46287937 TTGTCCTTTTTGAACATTGTTGG + Intergenic
1128191857 15:65708397-65708419 TTGTTCTCATAGAAAAGTGTGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1134060075 16:11194145-11194167 TTCTGCTTGTAGAGTATTGTGGG + Intergenic
1134677534 16:16101202-16101224 TTGTATTTTTAGAATAGAGTTGG + Intronic
1135120114 16:19759003-19759025 TTTTCCTAGTAAAATATTGTGGG + Intronic
1135267129 16:21036977-21036999 TTGTAATTGTAGAAAAGTTTTGG - Intronic
1135599459 16:23769645-23769667 TTGTCCTTGTAGGTTCCTGTTGG - Intergenic
1135998285 16:27269544-27269566 TAGTTCTTGCAAAATAGTGTTGG + Intronic
1137658376 16:50181140-50181162 TTGGTCTTGTACAAAAGTGTTGG + Intronic
1140737516 16:77911494-77911516 TTGGCCTTGTAGAATAGCAAGGG - Intronic
1141329760 16:83099937-83099959 TTGGCTTTGTAGGACAGTGTGGG - Intronic
1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG + Intronic
1146629052 17:34457160-34457182 TTGTCCTTGGAAAAGAGTGGAGG - Intergenic
1150273225 17:63880178-63880200 GTGTCCTTGTATAATATTATGGG - Intronic
1150551737 17:66216886-66216908 TTATCCTTGTAATAAAGTGTTGG + Exonic
1153134537 18:1899577-1899599 TCGTACTGGTAGAATAATGTAGG + Intergenic
1154003835 18:10508599-10508621 TTGTTCTTGGAGAACTGTGTAGG - Intergenic
1154179312 18:12117831-12117853 TTGTCCTTTTATTATACTGTTGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1157054905 18:44215823-44215845 TTGAAATTGTAGAATAGAGTAGG - Intergenic
1157492514 18:48134363-48134385 CTGTCCTAATAGAATGGTGTTGG - Intronic
1159472468 18:68875349-68875371 TTGTCCTTGTAGAAAGGAGAAGG + Intronic
1162304525 19:9863814-9863836 TTTTCCTTATAGATTAGTGGGGG - Intronic
1168136978 19:54358731-54358753 CTGTCCTGGTAGAATCGTTTAGG - Intronic
1168161106 19:54510398-54510420 CTGTCCTGGTAGAATCGTTTAGG + Intronic
925435330 2:3832452-3832474 TTGTGTTTGTAGGAGAGTGTTGG + Intronic
925699759 2:6624458-6624480 CTGTATTTGTAAAATAGTGTTGG + Intergenic
927540361 2:23904923-23904945 AGGACTTTGTAGAATAGTGTTGG - Intronic
933133161 2:78698608-78698630 TTTTTCTTGTAGCATAGGGTTGG + Intergenic
933638777 2:84736934-84736956 TTGTCCTTTCAGTATAATGTTGG + Intronic
935297184 2:101660248-101660270 TTAGCCTTGTAGAATAATTTGGG + Intergenic
936395985 2:112130485-112130507 TTGTCCTTGAAGACTATTTTTGG - Intergenic
938177568 2:129149009-129149031 CTGGCCTTGTAGAATAATTTTGG + Intergenic
940933990 2:159470064-159470086 TTATCCTTTCAGAATAGTGTTGG - Intronic
941246168 2:163099925-163099947 TTGTCCTTCTAGAATTCTGCAGG - Intergenic
942137768 2:172945090-172945112 TTGGCCTTTTAGAATACTGTTGG + Intronic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
946103398 2:217347616-217347638 TTGCCCATTTAGTATAGTGTTGG + Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1182133402 22:27876957-27876979 TAGTTCTTTTAGAATACTGTGGG + Intronic
1182784128 22:32892432-32892454 TTGGTTTTGTAGGATAGTGTGGG + Intronic
949766654 3:7534433-7534455 TTGCCCTCTTAGAATACTGTAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952224656 3:31362969-31362991 TTGCCCTTGTTCACTAGTGTGGG - Intergenic
953435093 3:42871657-42871679 TGGTCCTTGTAGAATAGGATGGG + Intronic
954919480 3:54177334-54177356 TTCTTCTTGTAAAATAATGTTGG - Intronic
956367104 3:68516149-68516171 TGGTCCTTTAAGAATATTGTAGG + Intronic
957187481 3:76961492-76961514 TTGACCTTCTAGATTAATGTGGG - Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959118178 3:102202250-102202272 TTGGCCTTGTAGAATGGGTTTGG + Intronic
959898596 3:111633864-111633886 TTGTCCTTGAACAACAGTATAGG - Intronic
963876765 3:150484288-150484310 TGTTCCTTGTAGATTTGTGTTGG - Intergenic
964669314 3:159208189-159208211 TTTTCCTTGAGGAATAGTCTGGG - Intronic
965627435 3:170695383-170695405 TTGTCCTGGTATAATACTTTAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967947191 3:194813397-194813419 TTGTCCTTGGAAAAAAATGTAGG + Intergenic
968197366 3:196718718-196718740 TTGGCCTTATAAAATAGTTTGGG + Intronic
971176643 4:24288689-24288711 TTGTTCTTGTAGAAAAATGCTGG - Intergenic
972128154 4:35796135-35796157 TTGTCCTTGTAGAATGAGTTTGG - Intergenic
972860059 4:43157139-43157161 TTGTCCTTGTAGAATGAGTTAGG + Intergenic
972893633 4:43591495-43591517 TTGTAATTGTAGAAATGTGTAGG - Intergenic
977088340 4:92634220-92634242 ATGTCCTTTTATAATACTGTAGG - Intronic
980874784 4:138650654-138650676 TTGTCCTTTGAGAACAGAGTTGG + Intergenic
981082287 4:140647540-140647562 CTGTCCTTGTAAAACTGTGTTGG + Intronic
981394819 4:144234795-144234817 TGGTTCTTGTAGACTTGTGTAGG - Intergenic
981656704 4:147119915-147119937 TGGTCCTTGTTGAATGCTGTTGG + Intergenic
982667775 4:158287881-158287903 TCTTCCTTTTGGAATAGTGTGGG + Intergenic
983421637 4:167526329-167526351 TGGTCCTTGTAGAATTGTAGAGG + Intergenic
984000150 4:174230816-174230838 TTTTCCTTGGAGAATGGTTTTGG + Intergenic
986206769 5:5631851-5631873 GTGTCCTTGTAGGAAAGTGCCGG - Intergenic
986275370 5:6270581-6270603 TTGCCCGTGAAGAATGGTGTTGG - Intergenic
986496003 5:8342368-8342390 TTGTCCTTTTTGATTATTGTTGG - Intergenic
986861703 5:11933737-11933759 TGGTCCTTGTAGCTTTGTGTTGG - Intergenic
987442457 5:17972759-17972781 TTTTCCTTGTAGAATGCTCTAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989695814 5:44199850-44199872 TTGTTTATGTAAAATAGTGTTGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993972087 5:94432113-94432135 TTGTCCTCGTAACATATTGTAGG - Intronic
993992080 5:94670060-94670082 TTCTCCTTCTAGAATACTGCTGG - Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
994644139 5:102448632-102448654 TTGTCCTTTTTGATTATTGTTGG + Intronic
994964176 5:106645207-106645229 TAGTCCTTTTATAATAGTGCAGG + Intergenic
995837402 5:116412313-116412335 TTGTTCTTTTAGCATAGTTTGGG + Intronic
995900341 5:117058499-117058521 TTCACCTTTTTGAATAGTGTGGG - Intergenic
999022819 5:148188310-148188332 TTGTCCTTGTTATATATTGTTGG - Intergenic
1000435678 5:161205108-161205130 TTGTCCTCATAGAATAAGGTAGG - Intergenic
1002334271 5:178467275-178467297 CTCTCCTTGTAGAAATGTGTGGG + Intronic
1003710910 6:8588952-8588974 TTTTCCTTGCAGTATATTGTAGG - Intergenic
1005906757 6:30268039-30268061 TTTTCCTTGTAGAATTATTTGGG - Intergenic
1009858023 6:69289458-69289480 CTGTCCTTGTTGAATTGTGAAGG - Intronic
1012883448 6:104817636-104817658 CTGTCTTTGTAGAAGAGAGTAGG + Intronic
1014801433 6:125782613-125782635 TTGACCTTTTTGAATAGTGGAGG + Intronic
1014901350 6:126969540-126969562 GAGTCATTGTAGAATAGTTTAGG - Intergenic
1015118821 6:129679074-129679096 TTGTCTCTATAGAATACTGTAGG + Intronic
1015807641 6:137127447-137127469 TTTTCCTTGCAGAATGATGTGGG + Intergenic
1017397364 6:154017982-154018004 TTCACCATGTAGAATAATGTAGG + Intronic
1017788559 6:157775740-157775762 TTGCCCTTTTATAATAGTGCTGG - Intronic
1017831210 6:158131202-158131224 TTGTATTTCTATAATAGTGTTGG - Intronic
1020053627 7:5101158-5101180 TTGGCCTTGTAGAATGATATTGG + Intergenic
1022727034 7:32990575-32990597 TTGTCCGTATTGATTAGTGTAGG - Intronic
1022837959 7:34134943-34134965 TTGTTTTTGTGGAATAATGTAGG - Intronic
1024587292 7:50853254-50853276 TTGCCCTAGTAGGATAGTTTTGG + Intergenic
1025046547 7:55697055-55697077 TTGTCCGTATTGATTAGTGTAGG + Intergenic
1027836569 7:83251576-83251598 TTGTCCCCTGAGAATAGTGTTGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030244387 7:107365929-107365951 TATTCATTGAAGAATAGTGTAGG - Intronic
1030476473 7:110039956-110039978 CTGGCCTTGTAGAATAGGTTTGG + Intergenic
1030599386 7:111576013-111576035 TTGGCCTTGTAGAATGAGGTTGG - Intergenic
1030748635 7:113201155-113201177 TTGTTCTTTTAGGATATTGTGGG - Intergenic
1033020281 7:137717964-137717986 TTGTCCTGGTAGAAAAGAATAGG - Intronic
1035913205 8:3592499-3592521 TTGTCCTTGTAAAATGGAGATGG + Intronic
1039086946 8:33789484-33789506 CTGGCCTTGTAGAGTAGTGGAGG + Intergenic
1039656444 8:39413606-39413628 TTGGCCTTGTAGAATGATATTGG - Intergenic
1042936197 8:74060936-74060958 TTGTCATTGTTGAATAGGGATGG - Intergenic
1044099124 8:88108770-88108792 TTTGCTTTGTAGAATAATGTGGG + Intronic
1044315134 8:90741627-90741649 TTGTCCTTTCAGTATAATGTTGG + Intronic
1046335775 8:112784898-112784920 TTGTCCTTGTAGAATGAGTTTGG - Intronic
1047686251 8:127307474-127307496 TTGTCCTTGTGGAACAGTTTAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050817970 9:9839166-9839188 GTAGCCTTGTAGTATAGTGTTGG + Intronic
1051794321 9:20847669-20847691 TTTTCCATGTAGAAGAGTTTTGG + Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1058128404 9:101222751-101222773 TTGTTGGTGTACAATAGTGTCGG + Intronic
1058172847 9:101703748-101703770 TTGTCCTTGTGGAATTGTTTTGG + Intronic
1058967693 9:110052510-110052532 TTTTCCTTTTAGAATAGAGATGG - Intronic
1060486389 9:124050045-124050067 TTTTCCTTGTCTAATTGTGTAGG + Intergenic
1187758723 X:22556285-22556307 TTGTCATTGTAGAAAATGGTTGG + Intergenic
1187852637 X:23606362-23606384 ATGTCCTTGTAGACAAGGGTGGG + Intergenic
1190480745 X:50874154-50874176 ATGTCCAAGTAGCATAGTGTTGG - Intergenic
1192396903 X:70791244-70791266 TTGTCCTTTTTGACTATTGTTGG - Intronic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193421461 X:81287871-81287893 TTGGCCTTGTAGAATGATTTTGG - Intronic
1193422946 X:81306541-81306563 TTGTCCTTTTAAATTACTGTTGG + Intergenic
1194061928 X:89214364-89214386 TTGTCTTTCTAGAGTAGTTTTGG + Intergenic
1195415292 X:104613269-104613291 TTGTCCTTTCAGTATAATGTTGG + Intronic
1195950744 X:110270086-110270108 TTGTCCTTATAAAAGACTGTTGG - Intronic
1197550928 X:127891867-127891889 ATGGCCTTGTAGAATAGGTTTGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199899952 X:152163323-152163345 CTGTCCTTGTACACAAGTGTAGG - Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic