ID: 1145233239

View in Genome Browser
Species Human (GRCh38)
Location 17:21190328-21190350
Sequence AGTTTGTTTTAGGTGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145233239_1145233245 29 Left 1145233239 17:21190328-21190350 CCTTCTAACACCTAAAACAAACT 0: 1
1: 0
2: 0
3: 15
4: 243
Right 1145233245 17:21190380-21190402 AATACTTGACATCGAGAACAGGG 0: 1
1: 0
2: 0
3: 9
4: 96
1145233239_1145233244 28 Left 1145233239 17:21190328-21190350 CCTTCTAACACCTAAAACAAACT 0: 1
1: 0
2: 0
3: 15
4: 243
Right 1145233244 17:21190379-21190401 TAATACTTGACATCGAGAACAGG 0: 1
1: 0
2: 0
3: 1
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145233239 Original CRISPR AGTTTGTTTTAGGTGTTAGA AGG (reversed) Intronic
901945159 1:12696170-12696192 TGTTTGTTTTTGTTTTTAGATGG + Intergenic
902065853 1:13685949-13685971 AGGTTATTTTAGGAATTAGATGG + Intergenic
903692748 1:25185820-25185842 AGTTTGGATTTGGTGTGAGAGGG + Intergenic
904190342 1:28737925-28737947 AGTTTCCTGTAGGTCTTAGAAGG + Intronic
907134005 1:52121951-52121973 ATTTTGTTTCATGTGTTAGGGGG + Intergenic
907987197 1:59543791-59543813 GGTTTGTTTTATGTTTTTGAGGG + Intronic
910487339 1:87730017-87730039 AGCATGTTTAAGGGGTTAGAAGG - Intergenic
912042341 1:105408252-105408274 AGGTTGTTGTAGATGTTAGATGG + Intergenic
912319751 1:108702129-108702151 AGTTTGTTTTTGTTTTGAGACGG + Intergenic
912986668 1:114440103-114440125 AGTCTTTTTGAGGTGATAGAGGG - Intronic
914200650 1:145481801-145481823 AATTTGTTTTAGATGTTCAAAGG - Intergenic
914872928 1:151490399-151490421 ACTTTGTTTTCGTTTTTAGATGG + Intergenic
916705434 1:167344615-167344637 AGTTTTTCTTAGCTGTAAGATGG + Intronic
917717499 1:177753209-177753231 AGTTTGTTTTTGGGGTCATATGG - Intergenic
918225856 1:182482306-182482328 AGCTTGTTCTGGATGTTAGAGGG - Intronic
918492813 1:185100188-185100210 TTTTTGTTTTAGGTATTAAATGG + Exonic
919662359 1:200259782-200259804 TGTTTGTTTTTGTTTTTAGATGG + Intergenic
921410277 1:214828846-214828868 AAGTTGTTTTAGATCTTAGATGG - Intergenic
921806186 1:219458195-219458217 ACTTTCATTTAAGTGTTAGAGGG - Intergenic
921908667 1:220524327-220524349 ACTTTGTTTTAGGTACTACAAGG - Intergenic
922089492 1:222382194-222382216 AGTGTGTTGTAGGTGTCAGAGGG - Intergenic
922788499 1:228295836-228295858 AGTTTATTTTGCATGTTAGACGG - Intronic
1063704158 10:8414779-8414801 AGTTTGTGTTAGATTTTAGCTGG - Intergenic
1063786701 10:9393298-9393320 AGTTTGTCTTAAGTGGTAGGTGG - Intergenic
1064818070 10:19289715-19289737 ATTTTGTTTTTTGTGTTTGAAGG + Intronic
1065207139 10:23367540-23367562 AGTTTGTTTTGAGTATTAAATGG - Intergenic
1066691179 10:38030199-38030221 AGTTTGTTTTTAGTTTTAAATGG - Intronic
1067001518 10:42618474-42618496 AGTTTGTTTTTAGTTTTAAATGG + Intronic
1068675322 10:59764118-59764140 GCTTTGTATTAGGTATTAGATGG - Intergenic
1068725370 10:60295057-60295079 AGTACATTTTAGCTGTTAGACGG - Intronic
1068854092 10:61779659-61779681 ACTTGATTTTTGGTGTTAGAAGG - Intergenic
1068895895 10:62200754-62200776 ATTTTCTTTTAGGTTTTAAAAGG + Intronic
1068925541 10:62532755-62532777 AGTTAGTTTCAGTTGGTAGATGG - Intronic
1069504329 10:68983956-68983978 AGTTTGTTTTAGCTGCTTGGAGG + Exonic
1070184814 10:74051239-74051261 TGTTTGTTTTTTGTTTTAGACGG + Intronic
1070189253 10:74096482-74096504 AGATAATTTTAGGTGTTACATGG - Intronic
1074604608 10:114948944-114948966 AGTTTGTATTAGGCCTTTGAAGG - Intronic
1077460315 11:2705801-2705823 AGTTTGTTTTACGCATTAAAAGG + Intronic
1079329058 11:19519221-19519243 AGTTGGTATTTGGTGGTAGAAGG - Intronic
1081000973 11:37670796-37670818 AGTTTCTTTTAGGTGTTTTCTGG - Intergenic
1086725293 11:90174905-90174927 AGTTTGTGTTAAGTGCTATAAGG - Intronic
1087739193 11:101868500-101868522 AACTTGTTTTAGGTCTTACAGGG - Intronic
1088215406 11:107502387-107502409 ACTTTGTAGTTGGTGTTAGAAGG + Intergenic
1088463124 11:110103958-110103980 TGTTTGCTTTAGATGTTAGGGGG + Intronic
1089188093 11:116634670-116634692 AGTTTGTTATAGCAGTTACATGG - Intergenic
1092713370 12:11362456-11362478 AGTTTGTTTTAGGGAGGAGAAGG - Intronic
1092717083 12:11401662-11401684 AGTTTGTTTTAGGGAGGAGAAGG - Intronic
1094131173 12:27077182-27077204 TGTTTGTTTGAGGTATTAGTAGG + Intergenic
1095159786 12:38903737-38903759 AGCTTGCTTTCGATGTTAGAGGG - Intronic
1096363904 12:51012064-51012086 AGTTTCTTCTAGTTGTCAGAGGG - Intronic
1097293161 12:57936817-57936839 AATTGGTTTTAAGTGTTAGCAGG + Intergenic
1098306323 12:69106369-69106391 AGTGTGTATCAGGTGTGAGAAGG - Intergenic
1098314785 12:69181943-69181965 TGTTTATTTTAGGCCTTAGATGG - Intergenic
1098330895 12:69352298-69352320 GGTATGTTTTAAGTGTTAAAAGG + Exonic
1099215428 12:79847265-79847287 AATATTTTTCAGGTGTTAGAAGG - Intronic
1099604807 12:84790141-84790163 AGTTTGTTTTAGCAGTTACTAGG + Intergenic
1099640125 12:85276179-85276201 AGTTTGTTGTTGTTGTTAGGTGG - Intergenic
1099713703 12:86264383-86264405 TGTTTGTTTTTGTTGTTTGAGGG + Intronic
1099948613 12:89274450-89274472 AGATTGTATTAGGTCTGAGAAGG - Intergenic
1100494448 12:95111408-95111430 AATTTGTTTTATGTGTAAAATGG + Intronic
1101690376 12:107073930-107073952 AGTTTGTTTTAGGTGTATTGAGG - Intronic
1102775777 12:115517609-115517631 AGTTGGTTCTAGGTGTTTGTAGG - Intergenic
1102937257 12:116908089-116908111 TTTCTGTTTTAAGTGTTAGATGG + Intergenic
1103802979 12:123551413-123551435 AGTTTGTTTCAAGTCTGAGAGGG - Intergenic
1106681251 13:32010687-32010709 ATTTTTTCTCAGGTGTTAGAAGG + Intergenic
1107621877 13:42241295-42241317 AGTCTGTTTAAGGTATTAGGAGG + Intronic
1109446413 13:62446852-62446874 TGTTTGTTTTTGTTGTGAGACGG - Intergenic
1109606794 13:64707050-64707072 ATTTTGTTTCAGGTCTGAGAGGG + Intergenic
1109704596 13:66073411-66073433 AGGTTGTTTTAATTGTTAGCAGG + Intergenic
1110855068 13:80287607-80287629 AGTTTGTTATAAGTTTAAGATGG + Intergenic
1111083905 13:83348340-83348362 ATTTTGTTTCAGGTGTTATTTGG - Intergenic
1111342546 13:86906352-86906374 AATTTGCATTAGGTGTTAGAAGG - Intergenic
1111674626 13:91371659-91371681 TGATTATTTTAGGTGTTAAATGG - Intergenic
1112192090 13:97188054-97188076 AGGCTGTTTTAGGTTTCAGAGGG + Intergenic
1113267562 13:108635823-108635845 CCTTTGTTTTGGGTGTTGGATGG + Intronic
1114279572 14:21179310-21179332 TGTTTGTTTTTGTTTTTAGAGGG + Intergenic
1114540191 14:23449605-23449627 AGTTTGTTTTGTGTGTTTCAGGG - Intergenic
1118619377 14:67600612-67600634 AGTTTGTTTTTGTTTTGAGACGG + Intergenic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1120050072 14:79855788-79855810 AGTATTTTTTATATGTTAGATGG - Intronic
1120933413 14:89871250-89871272 AGTTTGTTTTGGGAGATGGATGG - Intronic
1121060473 14:90903681-90903703 AGATTGTTTTAAATGATAGAAGG - Intronic
1123111857 14:105874811-105874833 TGTTTGTTTTTGTTTTTAGACGG - Intergenic
1124215293 15:27802712-27802734 AGTTTATTTTGGGTGTGGGAGGG - Intronic
1125119088 15:36131773-36131795 AGCTTGTGTTAGGTGATTGAGGG - Intergenic
1125159855 15:36630619-36630641 AGTCTGTTTTTGCTGCTAGAAGG + Intronic
1128380392 15:67107816-67107838 GGTTTGTTTTAGGTTTTGGAAGG + Intronic
1130664708 15:85860007-85860029 TGTTTGTATTAGGTGTTACAGGG + Intergenic
1131778576 15:95829051-95829073 ATTTTCTTTCAGGTGTTAGGTGG - Intergenic
1132330965 15:101012501-101012523 AGGTTGTTTTAGGTGGTTGGCGG + Intronic
1133662348 16:7930637-7930659 GGGTTGTTTTAGGTGACAGAGGG + Intergenic
1135252206 16:20910190-20910212 GGTTTGTTTCAGGTCTTTGAGGG - Intronic
1135576006 16:23586336-23586358 AATTTTTTTTCGTTGTTAGATGG + Intronic
1138992913 16:62413293-62413315 AATTTGTTTTAGTTGTTAAGAGG + Intergenic
1139137573 16:64223483-64223505 TGTTTGTTTTAAATCTTAGAAGG - Intergenic
1140689972 16:77472666-77472688 GGTTTGTTTCAGGTGTTTCAAGG - Intergenic
1140707262 16:77642329-77642351 GTTTTTTTTTAGGGGTTAGAAGG - Intergenic
1141165665 16:81659347-81659369 GGTTTGTTCTGGGTGTTAGAGGG + Intronic
1145233239 17:21190328-21190350 AGTTTGTTTTAGGTGTTAGAAGG - Intronic
1145948433 17:28796002-28796024 AGTATGTTTTAATTGTGAGATGG + Intronic
1146276843 17:31521700-31521722 AGTTTGCCTTAGCTGTTAAATGG + Intronic
1146462027 17:33053948-33053970 ATTATGTTTGAAGTGTTAGATGG - Intronic
1146975076 17:37104212-37104234 AGTTTGGCTTAGGTGAAAGAGGG + Intronic
1147200295 17:38797149-38797171 AGTTTGTTTGAGGGGCTAGTTGG - Intronic
1148921637 17:51040523-51040545 GATTTGTTTTAGATGTTAGAAGG - Intronic
1149964310 17:61146533-61146555 AGGTTGTTTTAGATATTTGAGGG - Intronic
1153848845 18:9074132-9074154 AGTATTTTTAAGCTGTTAGATGG - Intergenic
1156580154 18:38365643-38365665 AGGTGGTTTTAGCTATTAGAGGG + Intergenic
1156741097 18:40329140-40329162 AGTATGTTTTAGCTGATACAGGG - Intergenic
1157970863 18:52266970-52266992 ATCTTGTTTTAGATCTTAGAGGG + Intergenic
1159143340 18:64423654-64423676 TGTTTGTTCCAGGTGCTAGAAGG + Intergenic
1162263901 19:9554250-9554272 AGTTTGTCAAAGATGTTAGAAGG + Intergenic
1168576473 19:57515833-57515855 ATTTTGTTTGAGGTGGTAGCTGG - Intronic
927336022 2:21925597-21925619 GGTTTGTTTTTGATGTTTGATGG + Intergenic
927644654 2:24870003-24870025 AGATTGTTTTAAGGGTAAGAAGG - Intronic
928525598 2:32136551-32136573 GCTTTGTTTTAGGTGGGAGAAGG + Exonic
928895450 2:36257233-36257255 AGTCTGATTTATGTGTTAAATGG - Intergenic
931401028 2:61931615-61931637 AGTTCATTTCAGGTGTTGGATGG + Intronic
932233454 2:70101887-70101909 TGTTTGTTTTTGTTTTTAGATGG - Intergenic
932903643 2:75726831-75726853 AGTTTGTCTTAGATGATTGACGG - Intergenic
933005648 2:76990499-76990521 AGTCTGTTTTATCTGATAGAAGG - Intronic
933256372 2:80085607-80085629 AGTTTGTTTAAAATTTTAGAGGG + Intronic
933876336 2:86624237-86624259 AGTTGGTTTGAGATGGTAGAAGG + Intronic
937329134 2:121013946-121013968 AGATTGTTTTAGCTATTTGAGGG - Intergenic
938440175 2:131323007-131323029 AGTTTTTTTTAGTTTTTAGATGG - Intronic
939808030 2:146798218-146798240 AGTTTGTTTTAGAGGTTGAATGG + Intergenic
942646741 2:178119730-178119752 ATTTTGTTTGAAGTGTCAGAGGG + Intronic
944183522 2:196923365-196923387 AGTTTGTCTTGGGTGTTCAAAGG - Intronic
946046845 2:216828502-216828524 GGATTGTTTTAGGTTTTAGGTGG - Intergenic
947560438 2:231144857-231144879 TGTTTGTTTTAGGAGTAAGAGGG + Intronic
948555712 2:238809494-238809516 AGTTTGTGATAGGGGCTAGAAGG - Intergenic
1173038653 20:39437816-39437838 AGATTGTTTTAGCTATTATAGGG + Intergenic
1173966785 20:47118498-47118520 ACATTGTTTGAGGTGTTGGATGG + Intronic
1174650440 20:52120265-52120287 ACTTTGTTATAGCAGTTAGAGGG + Intronic
1181771258 22:25127426-25127448 CGAGTGTTTTAGTTGTTAGAAGG + Intronic
1182109979 22:27716185-27716207 AATTGGTTTTAGCTGTTAGCTGG + Intergenic
1182141336 22:27961526-27961548 ATTTTCTTTTAGGTGTTTGTAGG + Intergenic
949973847 3:9435992-9436014 AGTTTGATCCAGGTGTTTGAAGG + Intronic
950417132 3:12875189-12875211 AATTTGGTTTAGGTTTCAGAAGG - Intergenic
950887011 3:16371517-16371539 AGATAATTTTAGATGTTAGATGG - Intronic
951720820 3:25695849-25695871 AGATTGTGTTAGGTGTTGGCAGG + Intergenic
952379281 3:32792065-32792087 AGTTTATTTAAGGTTTTACAAGG + Intergenic
956538711 3:70309303-70309325 ACTTTGTTGTAGGTATTAAAAGG + Intergenic
956539463 3:70319604-70319626 ACTTTATTTTAAGTTTTAGAAGG + Intergenic
956968527 3:74492712-74492734 AGTTTGTTCTTTGTGTTGGAAGG - Intronic
957530418 3:81433683-81433705 AGTATTATTTAGGTGTCAGAAGG - Intergenic
957708775 3:83825904-83825926 ACTTTGTATTATGTGGTAGATGG + Intergenic
959795090 3:110417392-110417414 AGTTTTTTATATGTGTTTGAAGG - Intergenic
960209796 3:114949242-114949264 TTTTTGTGTTAGGTGTGAGATGG - Intronic
960661060 3:120059391-120059413 AGTGTGTGTTAGGTGTTCCAAGG - Intronic
962329864 3:134468198-134468220 AAATTGTTAAAGGTGTTAGAAGG - Intergenic
964283714 3:155095175-155095197 AGTTTCTGTTATGTGTTAGGAGG + Intronic
965674904 3:171184316-171184338 AGTTTGTTTTATGTGTGAAATGG - Intronic
965907521 3:173727479-173727501 AGATAGTTTAAGGTGCTAGAAGG - Intronic
968888434 4:3351549-3351571 ATTTTCTTTTAAGTGTTAAAGGG - Intronic
970599975 4:17634136-17634158 ATTTTGTTTAAGATTTTAGAAGG + Intronic
970646229 4:18123340-18123362 AGGTTGTTTTGTGTGTTAAATGG + Intergenic
971731913 4:30395234-30395256 AAATTGTTTTAGGTATTAGGAGG + Intergenic
972074206 4:35063975-35063997 AGATTATTTAAGCTGTTAGACGG - Intergenic
974082647 4:57228694-57228716 TGTTGTATTTAGGTGTTAGAGGG + Intergenic
974468113 4:62283850-62283872 AGTGTGATTTTGGTGTGAGATGG + Intergenic
975243950 4:72096001-72096023 TGTTTGTTTCAGGTGAGAGAGGG + Intronic
977660667 4:99581464-99581486 AGGTAGTTTTAGTGGTTAGAAGG - Intronic
978940781 4:114434206-114434228 AGTTTGATTTTGGTGTAAGATGG + Intergenic
979577459 4:122311300-122311322 AATTTATTTTGGGTTTTAGAGGG + Intronic
981275180 4:142891207-142891229 AGTTTATTTTAGGTTAAAGAGGG + Intergenic
981640776 4:146941270-146941292 GGCTTGTTTTAGGTTTTAAATGG + Intronic
981642373 4:146959351-146959373 ACTTTGTTTTAGGTCTGAGCAGG + Intergenic
981685306 4:147447813-147447835 AGTTTGTTTGTGGTGGTTGAAGG - Intergenic
981798498 4:148628233-148628255 GTTTTATTTTAGGTGTGAGAAGG + Intergenic
981877513 4:149565400-149565422 AGTCTCTGTTAGGTGGTAGATGG + Intergenic
982534607 4:156594618-156594640 TGTTTGGTAAAGGTGTTAGAAGG - Intergenic
982998277 4:162379689-162379711 TGTTTGTTTTTGTTTTTAGACGG - Intergenic
983075524 4:163321138-163321160 AGTTTGTCTTAGATCTCAGAGGG + Intergenic
984644303 4:182203284-182203306 AGTTTATTTTATGTGATAGCTGG - Intronic
986397968 5:7349196-7349218 AGTTTGTTTTAAAAGTTATATGG - Intergenic
988100195 5:26666696-26666718 AGTTTTTTTTAAGTGTTAATGGG - Intergenic
988185086 5:27849816-27849838 ATCTGGTTTTAGTTGTTAGAGGG + Intergenic
988411153 5:30887555-30887577 AGTTGGATTTATGTTTTAGAAGG - Intergenic
988678754 5:33462512-33462534 ACTTTGTTTTGGGATTTAGATGG + Intronic
992260045 5:74960302-74960324 ACTTCTTTTTAGGTGTTAAAAGG + Intergenic
992575414 5:78105621-78105643 ATTTTGTTATAGGTGTTATTTGG + Intronic
993054193 5:82962497-82962519 AGTTCGTATTAAGTGTTAAATGG + Intergenic
993332966 5:86622610-86622632 AGTTTATTGTAAGTGGTAGAGGG + Intergenic
996390672 5:122957479-122957501 AGATTGTTTTGGGTATTTGAGGG + Intronic
997457660 5:134029136-134029158 AGTTGGTGCTAGATGTTAGATGG - Intergenic
998404151 5:141864157-141864179 AGCTTGTGAGAGGTGTTAGAAGG + Exonic
1001197377 5:169685881-169685903 AGCTTGTCTTTGGAGTTAGATGG - Intronic
1003800350 6:9658000-9658022 AGTTTATTCTAGGTGGTGGAGGG + Intronic
1005484953 6:26290678-26290700 ATTTTGTTTAAGGTGGTAGCTGG + Intergenic
1006532463 6:34668532-34668554 AGTTTATTTTAGGTCTTGGGTGG - Intronic
1008080154 6:47186110-47186132 TGTTTGTTTTATGTCTTAGAAGG + Intergenic
1010977726 6:82335022-82335044 AAATTGTGTTAGGTGTTATAGGG - Intergenic
1011142252 6:84171431-84171453 ATTTTTCTTTTGGTGTTAGATGG - Intronic
1011763915 6:90598182-90598204 ATTTTGTTTTAGTTGTTAATCGG + Intergenic
1012291775 6:97464820-97464842 AGTTTTTTTTATGTGATATAGGG + Intergenic
1012758887 6:103270290-103270312 AGTTTGTTGTAGTTGTTTTAAGG + Intergenic
1013113108 6:107079807-107079829 CGTTTGTTTTATGGATTAGATGG + Intronic
1013715758 6:112959478-112959500 TTTTTGTATTAGGTGTAAGAAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1017345465 6:153374761-153374783 AATATGTTTAAAGTGTTAGAAGG + Intergenic
1019454615 7:1119960-1119982 AATTTGTTTTATGTGTGATAGGG - Intronic
1020437670 7:8183189-8183211 AGGTAGGTTTAGGTGTCAGATGG - Intronic
1020515718 7:9116151-9116173 TGTTTGTTTTAATTGTGAGAAGG + Intergenic
1020943146 7:14565267-14565289 AGTTGGTTCTAGCTGTTAGTAGG - Intronic
1021461700 7:20894686-20894708 AGATTCTTTTGGGTTTTAGAAGG + Intergenic
1021972796 7:25981834-25981856 AGTTTGAATTAGCTGCTAGACGG - Intergenic
1022985917 7:35653279-35653301 AGTCTGTTTTATCTGTTATAAGG - Intronic
1024331960 7:48163748-48163770 AGTCTGTTTTATCTGTTATAAGG - Intergenic
1026242215 7:68586172-68586194 AGTATGTTTTATGGGCTAGATGG - Intergenic
1026424549 7:70277119-70277141 AGTTTGTATTTGGAGTTTGATGG + Intronic
1027397072 7:77767376-77767398 TGTTTGTTTTTGGTTTCAGATGG + Intronic
1027742117 7:82022063-82022085 AGTTTGTTTTAGATATTAAAAGG + Intronic
1028102175 7:86833863-86833885 AATTTGTTTTATGTATTTGAAGG + Intronic
1028859724 7:95635223-95635245 AATTTGTTTTAGGTGAATGAAGG + Intergenic
1030502238 7:110374249-110374271 AATTTTTTTTAGGCCTTAGAAGG + Intergenic
1030593708 7:111511144-111511166 AGGGTGTTTTAGTTGTAAGAGGG - Intronic
1031242899 7:119268947-119268969 AGTGTGTTTTTGGTGGTAGCAGG + Intergenic
1034130765 7:148714890-148714912 TGTTTGTTTTGTGTGTGAGAGGG + Intronic
1036580718 8:10072565-10072587 AGATTGTTTTAGCTGTTCTAAGG + Intronic
1037021007 8:13970094-13970116 AGTTTGTTGTATGTGCTACAAGG + Intergenic
1037338559 8:17815888-17815910 AGTGTGTTTTACATGTTACATGG + Intergenic
1039636267 8:39169386-39169408 AGTTTGTTTTGAGTGTTAAATGG + Intronic
1041553890 8:59131291-59131313 AGTTTCTATTAGGTGTTATTTGG + Intergenic
1041722413 8:60988162-60988184 AGTTGGGTTTTGGTGTTGGATGG - Intergenic
1042181311 8:66090438-66090460 TGTTTGTTTTAGGGTTTAGCTGG - Intronic
1042481765 8:69312597-69312619 AGTATGGTTTAGGTGTCAAAAGG - Intergenic
1042549704 8:69983461-69983483 ACTTTGCTTTAGTTGTTATACGG + Intergenic
1044096881 8:88077941-88077963 AGTTTGGTTTTTGTTTTAGATGG + Intronic
1044197498 8:89395359-89395381 ACTTATTTTTAGGTGGTAGAAGG + Intergenic
1045547084 8:103139185-103139207 ACCTTGTTTTAGGTGTAAGGTGG - Intronic
1046850983 8:118972563-118972585 TGTTTGTTTTAGTTTTTAGGGGG - Intergenic
1047025831 8:120823515-120823537 AGTTTGTTTTAGGAAAGAGAGGG - Intergenic
1050051147 9:1602889-1602911 AAGTTGTTTTAGGTGTTGGTTGG - Intergenic
1051054199 9:12964541-12964563 AGTGTGTTTCAGCTCTTAGATGG - Intergenic
1051392287 9:16578784-16578806 AGATTGTTTTAGGTGAATGAAGG + Intronic
1052955680 9:34251626-34251648 ATTTTCTTTTGGGGGTTAGAAGG + Exonic
1058646189 9:107133426-107133448 AATTTGTATTAGTTGTTAAAAGG - Intergenic
1059149053 9:111931052-111931074 AGTTTCTTCTAGTTCTTAGATGG + Intronic
1185486131 X:482986-483008 TGTTTGTTTTAGGTGATTCAGGG + Intergenic
1188249694 X:27877119-27877141 AGTTTGTTTTAGTTTTAAGAGGG + Intergenic
1189116367 X:38347141-38347163 AATTTGGCTTAGGTGTTTGAAGG - Intronic
1189280445 X:39817138-39817160 AGATAGTTTTAGGAGTCAGAGGG + Intergenic
1190330582 X:49232980-49233002 AGTTTGTGTTAGGTTTCAGGTGG + Intronic
1192548438 X:72033042-72033064 AGATTGTTTTAGCTGTTTTAGGG + Intergenic
1193230124 X:79034138-79034160 TGTCTGTTTCAGGTGTTAAAGGG - Intergenic
1193550052 X:82880753-82880775 AGTGTGTTTTTTGTGTTAGTAGG - Intergenic
1193927767 X:87509897-87509919 AGATTGTTTTAGGTATTTTAGGG + Intergenic
1195288237 X:103405995-103406017 AGTTGTTATTAGGTGATAGATGG + Intergenic
1195996149 X:110733504-110733526 ACTTTATATTAGGTGCTAGATGG - Intronic
1196465046 X:115962980-115963002 AGTTTGTTTTGCCTGTTATAAGG - Intergenic
1197593039 X:128432360-128432382 AGCTTGTTTTCAGTGTTTGAGGG + Intergenic
1198053365 X:132970053-132970075 AGTTTGTTTTGTATGTTGGAGGG + Intergenic
1198788990 X:140322051-140322073 AGATTGTTATAGCTGTTATATGG - Intergenic
1198890715 X:141392795-141392817 TGGTTTTTCTAGGTGTTAGAGGG - Intergenic
1199950405 X:152701508-152701530 AGTGTGTTAGAGGTGTTTGAGGG + Exonic
1199952677 X:152717782-152717804 AGTATGTTGGAGGTGTTTGAGGG + Exonic
1199957006 X:152750666-152750688 AGTATGTTGGAGGTGTTTGAGGG - Intronic
1199959276 X:152766953-152766975 AGTGTGTTAGAGGTGTTTGAGGG - Exonic