ID: 1145234839

View in Genome Browser
Species Human (GRCh38)
Location 17:21201198-21201220
Sequence GGGTTAGGGTCCCCATGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145234839_1145234858 27 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234858 17:21201248-21201270 AAAGGCACTGGCTTGGACTTGGG 0: 1
1: 0
2: 3
3: 28
4: 195
1145234839_1145234856 20 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234856 17:21201241-21201263 TTTCATAAAAGGCACTGGCTTGG 0: 1
1: 0
2: 1
3: 19
4: 207
1145234839_1145234857 26 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234857 17:21201247-21201269 AAAAGGCACTGGCTTGGACTTGG 0: 1
1: 0
2: 0
3: 19
4: 237
1145234839_1145234854 15 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234854 17:21201236-21201258 ACCACTTTCATAAAAGGCACTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1145234839_1145234845 -9 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234845 17:21201212-21201234 CCCTAACCCCGCCCCTGGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 181
1145234839_1145234843 -10 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234843 17:21201211-21201233 ACCCTAACCCCGCCCCTGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 132
1145234839_1145234853 9 Left 1145234839 17:21201198-21201220 CCCAAGCATGGGGACCCTAACCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1145234853 17:21201230-21201252 GTGGGAACCACTTTCATAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145234839 Original CRISPR GGGTTAGGGTCCCCATGCTT GGG (reversed) Intronic
902117412 1:14132818-14132840 GGGTTAGAGAACCCATGCTTGGG + Intergenic
905447859 1:38038930-38038952 GGGATATTGTCCCCATCCTTGGG - Intergenic
908115979 1:60940723-60940745 GGGTTTGAGCCCCTATGCTTGGG - Intronic
908511990 1:64856910-64856932 TGGTTAGGCTCCACATGCATGGG - Intronic
909065602 1:70931730-70931752 GGGTCAGGGTTCCCATGCTGTGG - Intronic
911557927 1:99368166-99368188 GTGTTGGAGTCCCCATGGTTTGG - Intergenic
911644142 1:100320625-100320647 GGGACAGGCTCCCAATGCTTTGG - Intergenic
912448028 1:109752107-109752129 GAGTTGGGGTCCCCAGGCTGAGG + Exonic
914667020 1:149840571-149840593 GGGGTCGGGTCCCCCTGCTGCGG - Exonic
914668747 1:149853219-149853241 GGGGTCGGGTCCCCCTGCTGCGG + Exonic
921080472 1:211735267-211735289 GAGTCAGTGGCCCCATGCTTGGG + Intergenic
1062854858 10:774880-774902 GGGTTAGGGTCACCGCGCTCGGG + Intergenic
1065630140 10:27671438-27671460 GTGTTAGGGTCACCATCATTGGG - Intergenic
1069839174 10:71328340-71328362 GAGTTAGGGGCTCCATGCCTGGG + Intronic
1069952868 10:72031632-72031654 GGCTTAGGGACCCAATGTTTGGG + Intergenic
1069995031 10:72336723-72336745 GGGTGCGGGTCCCCATGCCCAGG + Intronic
1070283359 10:75066317-75066339 GGGTTAGGGTCCCAATGAGAGGG - Intergenic
1078942718 11:16026321-16026343 GGCTAAGGGTGACCATGCTTTGG - Intronic
1087970777 11:104479843-104479865 TGGGCAGGGTCCCCATGATTAGG + Intergenic
1103988211 12:124781036-124781058 GGGACAGGGTCCCCAGGCTTGGG - Intronic
1107274970 13:38667711-38667733 GGCCCAGGGTCCCCATGCTGAGG + Intergenic
1108896454 13:55334755-55334777 GGGATGGGCTCCCCAGGCTTTGG - Intergenic
1120483391 14:85080826-85080848 GGGTTAGGCTCTCCATGCAAAGG + Intergenic
1129410337 15:75347511-75347533 GGGGTGGGGTCCCCGAGCTTGGG - Intronic
1129913269 15:79245493-79245515 GGGTCACGGTCCCCATCCTGTGG + Intergenic
1131116235 15:89797771-89797793 GGGTTGGGGTTCCCAGGCTGTGG - Intronic
1135854323 16:25992961-25992983 GCGTTAGGGGGCCCATTCTTAGG + Intronic
1136103702 16:28013685-28013707 CGCTTGGGGTCCCCATGCTGTGG - Intronic
1138047961 16:53745749-53745771 GGGTGAGGGTTCCGTTGCTTTGG + Intronic
1138402071 16:56754577-56754599 GGGCTACAGACCCCATGCTTTGG + Intronic
1138407728 16:56811463-56811485 GGCTTTGGGTCCCCAAGCCTGGG + Intronic
1139909824 16:70390936-70390958 AGGTTACGGTCACCCTGCTTTGG - Intronic
1145234839 17:21201198-21201220 GGGTTAGGGTCCCCATGCTTGGG - Intronic
1150504436 17:65683608-65683630 AGGTTAGGGTCCCACTGCCTAGG - Intronic
1153671697 18:7418330-7418352 TGGTAAGGGTCCCGATGGTTTGG - Intergenic
1155342361 18:24825754-24825776 GGGTGTGGGTCCCCAAGCATGGG + Intergenic
1161035018 19:2079713-2079735 GGGTCAGGGACCCCACGATTGGG + Intronic
1162283266 19:9717466-9717488 GGGTTAGGGTCTCCCTGACTGGG - Intergenic
1164475715 19:28574484-28574506 GGGGAAGGTTCCACATGCTTTGG - Intergenic
1164642173 19:29833859-29833881 GGGGTAGAGACCCCCTGCTTGGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
932570002 2:72933649-72933671 GGGTTAGGGGCCCCAGGCCGGGG - Intronic
937270824 2:120651095-120651117 GGGTGAGGGTTTCCATGCATGGG + Intergenic
945794247 2:214342232-214342254 GGGTTTGGGAACCCCTGCTTTGG - Intronic
1172314603 20:33943981-33944003 GCCTCAGGGGCCCCATGCTTTGG + Intergenic
1175702612 20:61151190-61151212 GGGTTGGGGACCCGAGGCTTTGG - Intergenic
1179061660 21:37984830-37984852 GGATGAGGGTTCCCATACTTGGG + Intronic
1181027179 22:20132870-20132892 GGGTTGGGGGCTCCAGGCTTCGG + Intronic
1184751591 22:46489430-46489452 GGTTTGGGGCCCCCAAGCTTGGG - Intronic
950469096 3:13173631-13173653 GGGTTGGGGTCCTCATGCAGGGG - Intergenic
953344248 3:42161756-42161778 GGGTGAGGGACCCAATGCTGAGG + Intronic
965232610 3:166072611-166072633 GGGTTGGGCTCCCAATGCCTGGG - Intergenic
968682819 4:1933151-1933173 TGGTGAGGGCCCCCACGCTTTGG + Intronic
970550685 4:17178025-17178047 AGGGTAGAGTCCCCATGATTCGG - Intergenic
977044452 4:92051466-92051488 GGGTGAGGGTCCTCTTCCTTTGG + Intergenic
980775530 4:137431330-137431352 GGGGTAGAGTCCCAATGCCTTGG - Intergenic
982079853 4:151778708-151778730 GGGTTGGGGACCCCTGGCTTAGG - Intergenic
986658436 5:10038060-10038082 GTGTTAGGGTCCCTGTGCTACGG - Intergenic
987009883 5:13751751-13751773 GGGTGAGGGTTCCCATACATAGG + Intronic
987492047 5:18593931-18593953 GGGGTGGGCTCCCCAAGCTTTGG + Intergenic
987519336 5:18959005-18959027 GGGATATGGTACCCATGGTTAGG - Intergenic
992033817 5:72751485-72751507 GGGGAAGGGTACCCATGCGTGGG + Intergenic
999185330 5:149703171-149703193 GGGTTAGGGTCACCAAGGGTAGG + Intergenic
1000144036 5:158435631-158435653 GGGTAAGGATCCAAATGCTTTGG + Intergenic
1001086064 5:168700832-168700854 GGGTTAGGGCTCCCATGGGTGGG - Intronic
1003779799 6:9411690-9411712 GGGTTAGGGACCCCTGGTTTAGG + Intergenic
1004148538 6:13092273-13092295 GGGTTGGGGACCCCTGGCTTAGG + Intronic
1006763733 6:36486531-36486553 GGACTAGGGTAGCCATGCTTTGG + Intronic
1007321845 6:41033380-41033402 GGCTCAGGGTGACCATGCTTGGG + Intronic
1010263716 6:73844897-73844919 GGCCCAGGGTCCCCATGCTATGG + Intergenic
1015507770 6:134007152-134007174 GGGCCATGGTCCCCATGCATAGG + Intronic
1016618520 6:146080564-146080586 AGGGTAGGGGCCCCTTGCTTAGG - Intronic
1019142369 6:169956908-169956930 GGGCTGGGGTCCCCATGTCTGGG + Intergenic
1019598938 7:1871877-1871899 GGTCTAGGGTCCCCACACTTGGG + Intronic
1023397815 7:39767589-39767611 GTGTTGAGGTCCCCATGCCTGGG - Intergenic
1023994893 7:45153350-45153372 GGGATGGGGTCAGCATGCTTAGG + Intergenic
1025134853 7:56402904-56402926 GTGTTGAGGTCCCCATGCCTGGG + Intergenic
1026682134 7:72474987-72475009 GGGTTTGATTCCCCAGGCTTGGG - Intergenic
1028732395 7:94166357-94166379 GGGTTAGGGTCTCCCTGACTAGG + Intergenic
1030055579 7:105581337-105581359 GGGTAAGGGCCCCCATGCCCCGG - Exonic
1035032420 7:155870097-155870119 GGGCCAGGGTCGCCATGCGTGGG + Intergenic
1035788082 8:2278269-2278291 GGGGGAGGGTCCCCAAGCATGGG + Intergenic
1035804725 8:2443444-2443466 GGGGGAGGGTCCCCAAGCATGGG - Intergenic
1036226238 8:6960146-6960168 GGGTGAGGGTCCTCATGGCTGGG + Intergenic
1036234829 8:7029474-7029496 GGGTGAGGGTCCTCATGGCTGGG + Intergenic
1042298990 8:67255136-67255158 GGGTTAGGGATCCCATACGTGGG + Intronic
1046534964 8:115497458-115497480 GGGTTTGGGACCCCAGCCTTGGG + Intronic
1052642279 9:31184050-31184072 GCGTTAGAGTTCCCATGCATGGG + Intergenic
1054264451 9:62904690-62904712 GGGTTGGGGTCCCAAGGCCTTGG + Intergenic
1059460389 9:114425915-114425937 GGGTTATGGTCCCCACTTTTTGG + Intronic
1061232336 9:129322033-129322055 GGGTTTCGCACCCCATGCTTAGG + Intergenic
1187402560 X:18974744-18974766 GGGTTAGGGTCCTGATGAATGGG - Intronic
1188674547 X:32922746-32922768 GGGTTTGGGGACCCCTGCTTTGG + Intronic
1188768183 X:34122631-34122653 GGGTTAGGATCTCCATGACTGGG + Intergenic
1189677105 X:43472761-43472783 GGGTTTGAGCCCCTATGCTTGGG - Intergenic
1194397570 X:93404276-93404298 GGCTCAGGGTCCCCCTGCTGTGG - Intergenic