ID: 1145235077

View in Genome Browser
Species Human (GRCh38)
Location 17:21202492-21202514
Sequence TCCAGGACCGGGGTTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145235077_1145235082 -5 Left 1145235077 17:21202492-21202514 CCAGTGGAAACCCCGGTCCTGGA 0: 1
1: 0
2: 1
3: 2
4: 109
Right 1145235082 17:21202510-21202532 CTGGAACCGACTGCCCCATCTGG 0: 1
1: 0
2: 0
3: 6
4: 66
1145235077_1145235086 9 Left 1145235077 17:21202492-21202514 CCAGTGGAAACCCCGGTCCTGGA 0: 1
1: 0
2: 1
3: 2
4: 109
Right 1145235086 17:21202524-21202546 CCCATCTGGAAACACAGCAGTGG 0: 1
1: 1
2: 3
3: 29
4: 258
1145235077_1145235088 10 Left 1145235077 17:21202492-21202514 CCAGTGGAAACCCCGGTCCTGGA 0: 1
1: 0
2: 1
3: 2
4: 109
Right 1145235088 17:21202525-21202547 CCATCTGGAAACACAGCAGTGGG 0: 1
1: 0
2: 2
3: 30
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145235077 Original CRISPR TCCAGGACCGGGGTTTCCAC TGG (reversed) Intronic
901227035 1:7619471-7619493 TCCAGGAGAGGGTTTTTCACTGG - Intronic
901760257 1:11466549-11466571 GCCAGGGCCGGGGCTGCCACTGG - Intergenic
904623406 1:31789001-31789023 TCCAGGTCCAGGGCTTCCTCCGG - Intergenic
905674898 1:39818323-39818345 TCCAGGGCCGGGGGTTCTGCTGG + Intergenic
907558050 1:55362321-55362343 TTCAGGACAGTGGTTTCCTCTGG + Intergenic
907640039 1:56179477-56179499 CCCAGGACTGTGGTTTCCAAAGG - Intergenic
912805891 1:112756885-112756907 TCCAGGTCTGTGGTTTACACAGG - Intergenic
914788830 1:150858399-150858421 TCCAGGTCCAGAGTTTCCAGAGG + Exonic
916733516 1:167587134-167587156 TCCAGGGCATGGGTTTCTACAGG - Intergenic
923107393 1:230865238-230865260 TCCAGGACATGGGGCTCCACCGG + Intronic
924611103 1:245574556-245574578 TCCAGGGCCGGTGTCTCCCCTGG + Intronic
1065694111 10:28363983-28364005 TCCAGGACCAGCCTTTCCAGAGG + Intergenic
1077399498 11:2346940-2346962 TCCGGGGTCGTGGTTTCCACAGG + Intergenic
1077422833 11:2460976-2460998 TGCAGGACCTGGGTTTCCGGGGG + Intronic
1083567553 11:63732721-63732743 TCCAGGCCCAGAGTTTTCACTGG + Intronic
1084357853 11:68651589-68651611 TCCTGGACCAGGGCTCCCACTGG + Intergenic
1088837901 11:113593966-113593988 TTCAGCACCCCGGTTTCCACTGG + Intergenic
1103181717 12:118917999-118918021 TTCAGGACCAGGGATTCCAAGGG + Intergenic
1104860341 12:131920179-131920201 TCCAGGCCCGCCGTCTCCACTGG + Intronic
1110985143 13:81957254-81957276 ATCAGGATGGGGGTTTCCACTGG + Intergenic
1113508472 13:110832628-110832650 TCCAGAACCCTGGTTTTCACGGG - Intergenic
1122929681 14:104927548-104927570 TCCCGGACCTGGGCTGCCACTGG - Intronic
1202862280 14_GL000225v1_random:90263-90285 TCCAGGGCCGAGATTCCCACTGG + Intergenic
1123466053 15:20516827-20516849 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1123760844 15:23431414-23431436 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124276777 15:28332803-28332825 TCCTGGAGCAGGGTTTTCACAGG - Intergenic
1124305923 15:28578803-28578825 TCCTGGAGCAGGGTTTTCACAGG + Intergenic
1127568509 15:60216645-60216667 TCCAGGAAAAGGGTTTCCAATGG - Intergenic
1128724739 15:69980049-69980071 TCCAGGACGCAGGTTTCCCCTGG + Intergenic
1130383232 15:83390107-83390129 TCCAGGACTGGGGTTTCATAGGG - Intergenic
1133667021 16:7978562-7978584 TCCAGGATTGGGGTTTGCAATGG + Intergenic
1134864437 16:17592153-17592175 ACCAGGACCGGTGTTGCCATGGG - Intergenic
1137622284 16:49883902-49883924 AGCAGGACCGGGCTTCCCACTGG + Intergenic
1142412606 16:89924037-89924059 TCCAGGACCAGGCTCTCCATCGG + Intronic
1142814939 17:2418021-2418043 TTCAGGACCGTGGATTCCCCTGG - Exonic
1143565320 17:7717291-7717313 TCCAGGCCCGGTTTTTCCCCCGG + Intergenic
1145235077 17:21202492-21202514 TCCAGGACCGGGGTTTCCACTGG - Intronic
1146435479 17:32842137-32842159 TCCAGGACTGGGGTTTTGCCAGG + Intronic
1148415186 17:47500838-47500860 TCCAGGAATTGGGTTTACACAGG - Intergenic
1153810843 18:8750397-8750419 TCCAGGACCGGGCTCTCTCCAGG - Intronic
1154337913 18:13480877-13480899 GCCAGGACGTGGGTTTTCACTGG - Intronic
1154405069 18:14083421-14083443 TCCATGAACAAGGTTTCCACGGG + Intronic
1156448551 18:37253956-37253978 ACGAGGGCCTGGGTTTCCACGGG + Intronic
1157606860 18:48931407-48931429 TCCTGAACTGGGGATTCCACGGG + Intronic
1160707188 19:535180-535202 TCCAGGGCCTGGGTGACCACAGG + Intronic
1162035725 19:7937676-7937698 TCCAGGGCCAGGGTTTCTCCAGG - Intronic
1167526233 19:49985585-49985607 GCCAGGTCCTGGGTGTCCACTGG - Intronic
927417988 2:22899309-22899331 TCCAGGGCCAAGGTTTCAACAGG + Intergenic
929029259 2:37635667-37635689 TGCAGGACTGGGGTTGCCTCAGG + Intergenic
931455874 2:62409466-62409488 TCCAGGAGCTGTGTTTCCAAGGG - Intergenic
932553209 2:72793999-72794021 TCCAGGAAAGGGGTGTCCCCTGG + Intronic
932813387 2:74843052-74843074 TCCCAGACCTGGCTTTCCACAGG + Intronic
935633102 2:105228109-105228131 TCCTGGATTGGGGTTTCCAAAGG + Intergenic
937153790 2:119703798-119703820 TCCAGGACTGCAGCTTCCACTGG + Intergenic
939215207 2:139228179-139228201 TCCAGAACCAGGATTTACACCGG - Intergenic
948980715 2:241493244-241493266 TCCAGGGGCTGGGTTGCCACAGG - Exonic
1170566933 20:17612837-17612859 GCAAGAACCGGGGTCTCCACAGG - Intergenic
1171217485 20:23362571-23362593 ACAAGGGCCGGGGTTTCCAGTGG - Intronic
1172184087 20:33020606-33020628 CCCAGGACGGGGGTTTCTAGAGG - Intronic
1173598071 20:44272612-44272634 TCCAGGCCTGGGGTTTGCAAAGG + Intronic
1175311895 20:58018077-58018099 TCCCAGAGCGGGCTTTCCACAGG - Intergenic
1179405221 21:41120396-41120418 TCCAGGACTGAGGTCCCCACAGG + Intergenic
1184178254 22:42802004-42802026 TCCAGGACCATGGTTCCCACTGG - Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185238479 22:49727990-49728012 TCCAGAGCCGGGGCTGCCACAGG - Intergenic
949766576 3:7533624-7533646 TTCAGGATTGGGGTTTCCTCTGG - Intronic
950495658 3:13332902-13332924 TCCAGCACCAGGGTTTGCTCAGG + Intronic
951012776 3:17699901-17699923 TCCAGCACCCGGATTTCAACCGG + Intronic
953349154 3:42201791-42201813 CCCAGGACTGGGCTTTCCTCAGG + Intronic
961375373 3:126461956-126461978 ACCAGGACCAGGGGTTCCATCGG + Exonic
964272127 3:154968034-154968056 TCCAAGACCAAGGTGTCCACAGG + Intergenic
965642296 3:170842606-170842628 GACAGGACCGGGGCTTCCATAGG - Intronic
968664963 4:1816015-1816037 ACCAGGTCCAGGGTTTCCACGGG + Intronic
969681445 4:8645533-8645555 TCCAGCACCGGGATATCCAGAGG - Intergenic
971240255 4:24881947-24881969 TTCAGGAGCTGGGGTTCCACAGG - Intronic
977002326 4:91519333-91519355 TCCCGGACTGGAGTTTCCAGAGG - Intronic
978341059 4:107721370-107721392 TCCAGGACCGGGGAGGCCGCAGG + Intergenic
981019453 4:140009905-140009927 TCTAGGACTGGGCTTACCACTGG + Intronic
981045790 4:140263820-140263842 TCCAGCAACACGGTTTCCACAGG - Intronic
981051601 4:140314806-140314828 TCCAGGGCCAGGGGTGCCACTGG + Intronic
984548968 4:181138340-181138362 TCCAAGGCCGGGCTTCCCACTGG - Intergenic
985508674 5:299319-299341 TGCAGGACTGGGGATGCCACAGG - Intronic
985739457 5:1606633-1606655 TGCAGGACTGGGGATGCCACAGG + Intergenic
987220494 5:15786155-15786177 TCCAGGATAGGCGTTTCTACCGG + Intronic
988738123 5:34043171-34043193 TCCAGGAGCGTGGTCTCCTCGGG + Exonic
992188121 5:74263595-74263617 ACCAGGACAGGGGTTTCTAGGGG - Intergenic
993960085 5:94286981-94287003 TCCAGGACAGGAGTTGGCACAGG + Intronic
997893271 5:137694029-137694051 TCCAGGACTGGGGGTTTCCCAGG + Intronic
1001436623 5:171704357-171704379 TCCAGGACTGGGGTTTTCCTAGG - Intergenic
1006789325 6:36688854-36688876 TCCAGGACCAGGGAATACACTGG + Intergenic
1006870969 6:37251682-37251704 CTCAGGATCGTGGTTTCCACTGG + Intronic
1008688787 6:53954042-53954064 TGCAGGACTGAGGTTTCCCCAGG + Intronic
1016939569 6:149473212-149473234 TGCAGGACCGAGGTTTGCAATGG - Intronic
1019541852 7:1555217-1555239 TTCAGGACCTTGGTCTCCACAGG - Intronic
1020309846 7:6859383-6859405 TCCAGCCCCGGAGTGTCCACAGG + Intergenic
1020686240 7:11298833-11298855 TCCAGGACCTGAGCTTCTACTGG - Intergenic
1021858141 7:24878185-24878207 TCCAGCACAGCTGTTTCCACAGG + Intronic
1023409071 7:39870104-39870126 TCCAGGCCCTGGGTAACCACCGG - Intergenic
1024189658 7:46993185-46993207 CCCAGCCCCAGGGTTTCCACTGG - Intergenic
1026981554 7:74529730-74529752 TCCAGGCCCAGGGCTTCCGCTGG - Exonic
1029521992 7:101068728-101068750 TCCAAGACCAGGGTATCCGCGGG + Intergenic
1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG + Intergenic
1031008482 7:116499891-116499913 ACCAGGACCGGGATCCCCACCGG + Exonic
1035297832 7:157877053-157877075 TGCAGCACCAGGGTTTCCTCGGG + Intronic
1035297867 7:157877169-157877191 TGCAGCACCAGGGTTTCCTCGGG + Intronic
1056828189 9:89891259-89891281 TCCAGGACCAGGATTTCCACTGG + Intergenic
1062287172 9:135778402-135778424 TCCAGGACCGCTGTCCCCACAGG + Exonic
1062627494 9:137449871-137449893 TCCACGTCGGGGGTTTCCAGAGG + Intronic
1186817255 X:13250045-13250067 TCCAGCACTGTGGTATCCACAGG + Intergenic
1195028143 X:100899159-100899181 TCCACTACCTGGGTTTCCTCAGG - Intergenic
1200120073 X:153786038-153786060 TGCAGGACTGGGATTGCCACAGG + Intronic