ID: 1145236842

View in Genome Browser
Species Human (GRCh38)
Location 17:21214318-21214340
Sequence TACGGGCCCCGGCGACCCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145236842_1145236850 -1 Left 1145236842 17:21214318-21214340 CCCCGGGGTCGCCGGGGCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1145236850 17:21214340-21214362 AGTCCTTCTGCGAGGGCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 45
1145236842_1145236847 -8 Left 1145236842 17:21214318-21214340 CCCCGGGGTCGCCGGGGCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1145236847 17:21214333-21214355 GGCCCGTAGTCCTTCTGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1145236842_1145236846 -9 Left 1145236842 17:21214318-21214340 CCCCGGGGTCGCCGGGGCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1145236846 17:21214332-21214354 GGGCCCGTAGTCCTTCTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1145236842_1145236852 7 Left 1145236842 17:21214318-21214340 CCCCGGGGTCGCCGGGGCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1145236852 17:21214348-21214370 TGCGAGGGCGCGAGGACTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 82
1145236842_1145236853 18 Left 1145236842 17:21214318-21214340 CCCCGGGGTCGCCGGGGCCCGTA 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1145236853 17:21214359-21214381 GAGGACTCCAGGAGCCGTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145236842 Original CRISPR TACGGGCCCCGGCGACCCCG GGG (reversed) Exonic
900166628 1:1246612-1246634 GCCGGGCCCCGACGCCCCCGAGG + Exonic
905789770 1:40783902-40783924 TGCGGGCTCCGGCGGCCCCCAGG + Intergenic
912446494 1:109740470-109740492 TTCAGGGCCTGGCGACCCCGAGG + Exonic
923631050 1:235649797-235649819 GACGGGACGCGGAGACCCCGCGG - Exonic
1063815567 10:9767595-9767617 TACAGGCCCCTGCCACCACGTGG - Intergenic
1071842133 10:89483393-89483415 TACTGGCCCTGGCGACTCTGGGG - Intronic
1074592009 10:114822173-114822195 TACGCTCCCCGGCGGCCTCGGGG + Intronic
1076801606 10:132833575-132833597 GACGGAGCCCTGCGACCCCGTGG - Intronic
1076905020 10:133357299-133357321 GACGGGCGGCGCCGACCCCGAGG - Intronic
1084295680 11:68212646-68212668 GCCGTGGCCCGGCGACCCCGCGG - Intronic
1101771963 12:107760642-107760664 GGCGGCCCCGGGCGACCCCGGGG - Exonic
1104270807 12:127280799-127280821 TGCGGGACCCGGCGGCACCGCGG + Intergenic
1105472090 13:20703786-20703808 GCTGGGCCCCGGGGACCCCGCGG + Intronic
1105502827 13:20988123-20988145 TGCGGGCCCCAACGAGCCCGAGG - Exonic
1106036723 13:26051035-26051057 TCGTGGCCCCGGCGACCCCCGGG + Intergenic
1112768957 13:102774503-102774525 CACGCGCCCTGTCGACCCCGAGG - Intergenic
1113473241 13:110561605-110561627 TCCGGGTCCCGGCGAGTCCGGGG - Exonic
1113567599 13:111328299-111328321 TAGACGCCCCGGCCACCCCGTGG + Intronic
1130261097 15:82355107-82355129 TGCGTGCCCCGGCCACCCCCGGG + Intergenic
1130280138 15:82513911-82513933 TGCGTGCCCCGGCCACCCCCGGG - Intergenic
1130471513 15:84230097-84230119 TGCGTGCCCCGGCCACCCCCGGG - Intergenic
1130479007 15:84344668-84344690 TGCGTGCCCCGGCCACCCCCGGG - Intergenic
1130492763 15:84443463-84443485 TGCGTGCCCCGGCCACCCCCGGG + Intergenic
1130593807 15:85234724-85234746 TGCGTGCCCCGGCCACCCCCGGG - Intergenic
1130613472 15:85381285-85381307 TACCGTCCGCGTCGACCCCGGGG - Intronic
1142509487 17:385273-385295 TACGGACCCAGGCGACCCTGGGG + Intronic
1145236842 17:21214318-21214340 TACGGGCCCCGGCGACCCCGGGG - Exonic
1146484644 17:33233064-33233086 TACGTGCCCTGGAGACCACGTGG + Intronic
1152718494 17:81911222-81911244 AGCCGGCCCCGGCGCCCCCGCGG + Intronic
1153794455 18:8609645-8609667 CCCGGGCCCCGGCGCCCCCTCGG - Exonic
1159106599 18:64008381-64008403 TACAGGCCCCTGCCACCACGCGG + Intergenic
1160991818 19:1863275-1863297 CCCGGGCCCCGGCGCCGCCGCGG - Exonic
1163145922 19:15379371-15379393 TCCGGCCCCCAGCGACCCCGGGG - Intronic
1167291218 19:48626110-48626132 AACGGGACCAGGCCACCCCGGGG - Exonic
927949392 2:27157139-27157161 TAAGGGCCTCGGAGACCCCCAGG - Intergenic
933791734 2:85888782-85888804 CGCGGGCCCCCGCGACGCCGAGG + Intronic
940009751 2:149040364-149040386 TACAGGCGCCGGCCACCACGTGG + Intronic
940211640 2:151261572-151261594 GAGGGGCCCCAGGGACCCCGGGG - Intronic
947792515 2:232876241-232876263 GCCGGGCCCCAGCGACCCTGCGG - Exonic
1175448424 20:59042548-59042570 TGCGGGCCCCGGCGACACGGAGG - Intronic
1175579400 20:60087447-60087469 GCCGGGCCTCGGCGTCCCCGCGG - Intergenic
1176194645 20:63831466-63831488 CGCGGCCCCCTGCGACCCCGCGG - Intergenic
1179570002 21:42273162-42273184 CACTGGCCACGGGGACCCCGAGG - Intronic
1182144767 22:27990652-27990674 CACGGGCTGCGGCGCCCCCGCGG - Intronic
1183679511 22:39319468-39319490 TAGGGGCACGGGCGACCCAGCGG - Intronic
1184698124 22:46150799-46150821 TCCGGGTCCCGGGGACCCGGGGG + Intronic
969436743 4:7193138-7193160 TAGGGGCCGCGGCGAGCGCGTGG - Intronic
969568241 4:7992752-7992774 GAGAGGCCCCGGGGACCCCGCGG - Intronic
983142736 4:164172838-164172860 TACAGGCCCCCGCCACCACGTGG - Intronic
985068445 4:186144977-186144999 CACGCGCCCCCGCGGCCCCGGGG - Exonic
992056595 5:72996871-72996893 TGCCGGCCCCGCCGGCCCCGGGG - Intronic
994171398 5:96662596-96662618 TGCAGTCCCCGGCGCCCCCGCGG + Intronic
1010229456 6:73521659-73521681 TACCAGGCCCGGGGACCCCGAGG + Intronic
1017446185 6:154509704-154509726 TGCGGTGCCCGGCGACCCGGGGG - Intronic
1017470420 6:154733320-154733342 TGCGAGCCCCGGCGGCCGCGCGG - Intronic
1019436884 7:1026980-1027002 TCCGGGCCCAGGTGACCTCGGGG - Intronic
1022100593 7:27166822-27166844 TACGGGGCCCGGAGACTCGGCGG + Intronic
1025840402 7:65141266-65141288 CAGGGGCCCCGGCCAGCCCGGGG + Intergenic
1025878312 7:65508898-65508920 CAGGGGCCCCGGCCAGCCCGGGG - Intergenic
1025882655 7:65554698-65554720 CAGGGGCCCCGGCCAGCCCGGGG - Intergenic
1025890788 7:65647905-65647927 CAGGGGCCCCGGCCAGCCCGGGG + Exonic
1029123313 7:98282066-98282088 TTCGGGACCCGGCGCCGCCGAGG + Intronic
1029139832 7:98401490-98401512 TGCTGGCCCCGGGGACCCCGAGG + Intergenic
1030782830 7:113623201-113623223 TATGGTCCCCGGTGACCCTGGGG + Intergenic
1034128970 7:148698744-148698766 CACCGGCTCCGGCGACCGCGGGG - Intronic
1038455789 8:27671182-27671204 TGAGGGCCCTGGAGACCCCGGGG - Exonic
1040324741 8:46335987-46336009 TACGGGCCACAGGGACCCAGGGG + Intergenic
1049789646 8:144466772-144466794 TCTGGGCGCCGGCGACCCCGGGG - Exonic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1060700621 9:125746976-125746998 TCCGAGCCCCGGCGGCCCCGGGG - Intergenic
1200002134 X:153067518-153067540 TCCAGGCCCCCCCGACCCCGGGG - Intergenic
1200005599 X:153082507-153082529 TCCAGGCCCCCCCGACCCCGGGG + Intergenic