ID: 1145242229

View in Genome Browser
Species Human (GRCh38)
Location 17:21246778-21246800
Sequence CAGGGCTGCCACTGTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145242215_1145242229 16 Left 1145242215 17:21246739-21246761 CCAAGGATCACTATACAGCAGAG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1145242229 17:21246778-21246800 CAGGGCTGCCACTGTAAAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145242229 Original CRISPR CAGGGCTGCCACTGTAAAGA GGG Intronic
900289592 1:1918271-1918293 CAGGGCTGTCACTGTCCATAGGG + Exonic
902392086 1:16112743-16112765 CAAGGCTGACACTGTAATTAAGG + Intergenic
903548732 1:24143044-24143066 CAGGGATCCCACAGTCAAGATGG + Exonic
904255054 1:29249477-29249499 CAGGGAGGCCTCTGTAGAGATGG + Intronic
909203734 1:72726136-72726158 AAGGTCAGCAACTGTAAAGATGG + Intergenic
911572291 1:99532803-99532825 GAGGGCAGCCACAGAAAAGAGGG - Intergenic
911708840 1:101045359-101045381 CAAGGCTGTTATTGTAAAGAAGG - Intergenic
914263349 1:146018224-146018246 CTGAGCTGCCACGGTAAAGTTGG + Exonic
918556699 1:185809613-185809635 CAGGAGTGCCACTGTACAAAGGG - Intronic
918674421 1:187264613-187264635 CTGAGCTGCCACTGTAATTAGGG - Intergenic
920851069 1:209628025-209628047 CAGGGCTGCCACCGTGAGTAGGG - Exonic
921029302 1:211323664-211323686 CCTGGCTGCCAATGTAAAGATGG - Intergenic
921518247 1:216124829-216124851 AAGGGTTACCAGTGTAAAGAAGG + Intronic
922782929 1:228268138-228268160 CAGTCCTGCCACTGTCAGGAGGG - Intronic
924797693 1:247304202-247304224 CAGGACTGCCACTGTCATCATGG + Intronic
1063264116 10:4426871-4426893 TTGGGCTGCTACTGTAAAAATGG - Intergenic
1064142562 10:12802952-12802974 CAGATGTGCCACTGCAAAGATGG - Intronic
1067268536 10:44769573-44769595 CAGGGCTGAGATTGTAAAGCAGG - Intergenic
1068192372 10:53668025-53668047 TAGAGCTTCCCCTGTAAAGAGGG + Intergenic
1069473999 10:68717385-68717407 CATGTATGCCACTGTGAAGACGG - Intergenic
1069701355 10:70428893-70428915 CAGGGCTGGCACTTAAGAGAAGG - Intergenic
1070546452 10:77456630-77456652 CAGAGCTGGCACTGGAAAGAGGG - Intronic
1074178741 10:111038051-111038073 TAGGGCTGCCACTGCAACAAAGG - Intergenic
1075207201 10:120457653-120457675 CAGGGCTGCACCTCTAAACAGGG + Intronic
1077548265 11:3186390-3186412 CAGAGCTGCTGCTGTCAAGAGGG - Intergenic
1078328089 11:10396756-10396778 CAGGTCTGCCACTTTGAAGCTGG - Intronic
1080166669 11:29245265-29245287 CAGGGCAGCCCTTGTAAGGAAGG - Intergenic
1083397040 11:62399473-62399495 CAGGGAGGCCACTGTAGAGCTGG - Intergenic
1083599593 11:63938761-63938783 CAGGGCTGCGTCTGTAACTATGG - Intergenic
1084095934 11:66911397-66911419 CCAGGCTGCTCCTGTAAAGAAGG - Intronic
1084370753 11:68741183-68741205 TATGGCTTCCACTCTAAAGAGGG - Intronic
1084486594 11:69451837-69451859 CTGAGCTGCCACAGTCAAGAAGG - Intergenic
1085258613 11:75191464-75191486 CAGGCCTGGCACAGAAAAGAGGG + Intronic
1086890366 11:92251233-92251255 AAGGGCTTCATCTGTAAAGATGG - Intergenic
1089113226 11:116073256-116073278 CAGGGCTGGGACTGTGAACATGG - Intergenic
1090963682 11:131579923-131579945 CAGGGCAGCCATTCTAAATATGG - Intronic
1091439719 12:503233-503255 CAGGGCTGGGACTGTAAACCAGG - Intronic
1097924163 12:65109393-65109415 CAGAGCTGCCTCTGTCCAGAGGG - Intronic
1104414298 12:128585091-128585113 CACGGCTGCAAGTGTGAAGACGG - Intronic
1104431463 12:128719785-128719807 GAGGGAAGGCACTGTAAAGATGG - Intergenic
1105585420 13:21738660-21738682 CAGGGCTGGGACTGGAACGAGGG + Intergenic
1106973740 13:35179639-35179661 CAGCGCTGCCACTGTGTAGTTGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112429574 13:99338886-99338908 CAGGGCTGCCAGTGAAGAGAAGG - Intronic
1113586494 13:111469561-111469583 CAGGGCTGCTGCTGTTAAGGAGG + Intergenic
1114818292 14:25985869-25985891 AAGGGCTGGCACTGTAAAGCAGG - Intergenic
1117914220 14:60660287-60660309 CTTTGCAGCCACTGTAAAGATGG + Intergenic
1120079827 14:80203150-80203172 CAGGGCTGGCAAAGTCAAGAAGG + Exonic
1124400771 15:29345633-29345655 CAGGGCTGCCACTGTGAGCCTGG - Intronic
1125582449 15:40795972-40795994 CAGGGCTGCAAGTGGAAAGATGG + Intronic
1128509928 15:68307185-68307207 TAGGGCAGCCGCTGAAAAGAGGG - Intronic
1128752055 15:70156790-70156812 CAGGGCTCCCAGTGGCAAGAAGG + Intergenic
1129852010 15:78798788-78798810 CAGGGCTCCAACAGGAAAGAAGG + Intronic
1130250989 15:82300299-82300321 CAGGGCTCCAACAGGAAAGAAGG - Intergenic
1131168264 15:90158382-90158404 CGGGGCAGCCACAGTACAGATGG + Intergenic
1131873715 15:96783716-96783738 CAAGGCAGCCTCTGAAAAGAGGG - Exonic
1132296018 15:100735044-100735066 CATGGCTGCCACTGATAAAATGG - Intergenic
1132543485 16:522346-522368 CAGTGCTGTCACTGTAAGCATGG + Exonic
1142345484 16:89551222-89551244 CTGGGGCTCCACTGTAAAGACGG - Intronic
1143608693 17:8005204-8005226 CAGGGCAGTGACAGTAAAGATGG - Intronic
1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG + Intergenic
1145242229 17:21246778-21246800 CAGGGCTGCCACTGTAAAGAGGG + Intronic
1149010427 17:51850975-51850997 CAGGGCAGGCACTGGGAAGAAGG - Intronic
1150977979 17:70110197-70110219 CAGGGCTGCCACTGACATAAAGG + Intronic
1152335545 17:79698564-79698586 CAGTGCTGCCAATGTGCAGAGGG + Intergenic
1156268449 18:35509195-35509217 CAGGCCTGGCACTGAGAAGAGGG - Intergenic
1157134204 18:45038158-45038180 CAGCACAGCCTCTGTAAAGATGG + Intronic
1158094520 18:53755573-53755595 CATTGATGCCACTATAAAGAGGG - Intergenic
1160392049 18:78541200-78541222 CAGGGGTGCCATTGGAAAGATGG + Intergenic
1160534021 18:79581544-79581566 CAGGCCTCCCCATGTAAAGAGGG - Intergenic
1162080724 19:8216076-8216098 CAGGGCTACAATTTTAAAGAGGG - Intronic
1166363975 19:42269396-42269418 CAGGGCTGACACAGGAAAGGGGG + Intronic
928087607 2:28355740-28355762 CACAGCTGCCACTGTAGATAAGG + Intergenic
928125749 2:28614617-28614639 TAGGACGGCCACTGCAAAGACGG + Intronic
929683103 2:44011251-44011273 CAGGACTTTCACTGTAAAGAGGG - Intergenic
932354673 2:71058971-71058993 CAGGGCTGACTCAGGAAAGAAGG + Intergenic
933660994 2:84926872-84926894 CATGGCTGCCAGTGCTAAGAGGG + Intergenic
933784801 2:85830009-85830031 CAGGACTGCCTCTGTATGGAGGG + Intergenic
936998463 2:118439616-118439638 CAGGGCTGCCCCTGGACTGAGGG + Intergenic
937750566 2:125472159-125472181 CAGGGCAGCCACTGTGGTGAGGG - Intergenic
937984598 2:127632869-127632891 CACGGCTGCCACTGAAATTATGG - Intronic
941515048 2:166463277-166463299 CTGGACTGCCACTGTAATAATGG - Intronic
948236034 2:236391447-236391469 CAGGGCTGTCTCTGGAATGAAGG + Intronic
948366145 2:237456118-237456140 CAGGGTTGGCAATGGAAAGAAGG - Intergenic
1168910667 20:1444223-1444245 CAGGGGAGCCTCTGGAAAGAAGG - Intronic
1172436960 20:34935813-34935835 CAGGGCTTCCACTGAAAACAGGG + Intronic
1174163157 20:48565750-48565772 AAGGACTGCCACTCAAAAGAGGG - Intergenic
1175980146 20:62734626-62734648 CAGGGCTGCCACATTAGACAGGG - Intronic
1179552664 21:42153432-42153454 CAGAGTGGCCACTGTACAGAAGG + Intergenic
1179876061 21:44268122-44268144 CAGAGCTGCCACGGTGAACACGG + Intergenic
1181696636 22:24595943-24595965 CCTGGTAGCCACTGTAAAGAAGG + Intronic
1182569417 22:31225353-31225375 AAGGGCTGACACTGAAAAGAAGG + Intronic
1183210278 22:36447041-36447063 CAGGCCTGCCTCTGAGAAGAGGG - Intergenic
1183228532 22:36566314-36566336 CAGTCCTGCCACTGGGAAGAAGG - Intronic
1183280588 22:36929922-36929944 CAGGGACGCTACTGGAAAGATGG - Intronic
1183720948 22:39560953-39560975 CATGGCTGCCAGTCTACAGAGGG + Intergenic
950116705 3:10455450-10455472 CTGGGCTTCCTCTGTAAAGTGGG + Intronic
951821568 3:26819670-26819692 CAGGACTGCCATTGTAAACCTGG - Intergenic
953046013 3:39294696-39294718 CAGGGCTCCCACTGAGAGGAGGG - Intergenic
953327018 3:42020802-42020824 CAGGGCTCCCACAGTAAACTTGG + Intronic
953734513 3:45480429-45480451 CAGGGCACCCACTGGAAAGAAGG - Intronic
955599497 3:60629993-60630015 CAGGGCAGCCAGTGTAACAAAGG - Intronic
956457640 3:69439322-69439344 CAGGGAGGCCTCTGTACAGAAGG - Intronic
957085545 3:75673191-75673213 TAGGGCTTCCACTGTAAAGTCGG + Intergenic
958945198 3:100354367-100354389 CTGGACTGCCATTGTAAAGGGGG + Intronic
960119296 3:113930811-113930833 CACTGCTGCCACTGAAAAGCAGG + Exonic
963600147 3:147371768-147371790 CAGGGCTGGCGCTGAAAAGTGGG - Intergenic
965717145 3:171617246-171617268 AAGGGCTGCCCCAGTAAAGAGGG - Intronic
965802746 3:172511443-172511465 CCTAGCTGCCAATGTAAAGAGGG + Intronic
966318598 3:178676400-178676422 CAGGGCTGGGACTGTCAGGAGGG + Intronic
966866669 3:184261925-184261947 CAGGGCTGGCAATGGAAAGCGGG + Intronic
968830353 4:2930423-2930445 CCAGGCTGCCACTGTGCAGAGGG + Intergenic
968982402 4:3857344-3857366 CAGGGCTACCACTGTATACTAGG + Intergenic
969973376 4:11071202-11071224 CAGGGCTGCTTCTGAAATGAGGG + Intergenic
971470683 4:27022801-27022823 CCGGGATGCCACTGGAAAGCTGG - Exonic
973163949 4:47053650-47053672 GTGGGCTGTCACTGGAAAGAAGG + Intronic
974568235 4:63607303-63607325 CAGGGTGGCGACTGCAAAGAGGG - Intergenic
974794117 4:66726673-66726695 ACTGTCTGCCACTGTAAAGAAGG - Intergenic
977191170 4:94002702-94002724 CAGTGCTGCAAATGTACAGAGGG - Intergenic
977477733 4:97534778-97534800 CAGGGCTGCATGTGTACAGAAGG - Intronic
978662321 4:111141951-111141973 CTGGGGTGCCACTGTAATGTGGG - Intergenic
979211804 4:118113715-118113737 CAGAGCTGCCATTGAAAATATGG + Intronic
981246268 4:142542871-142542893 CAGTGTTGCCACTATAAAAAAGG - Intronic
986496240 5:8344586-8344608 CAGGCCTGCCAGTGCACAGAAGG - Intergenic
992033733 5:72750250-72750272 TAGGGCAGCCACTGAAAAAAAGG + Intergenic
993098634 5:83509722-83509744 AAGGGCTGCAAGTGTAAAGAAGG - Intronic
994123954 5:96149536-96149558 CAAGGCTGCCCCTGTGAAAAAGG + Intergenic
995016905 5:107320080-107320102 CAGTTTGGCCACTGTAAAGAAGG - Intergenic
998049466 5:139020010-139020032 CTGTGCAGCCACTGGAAAGATGG - Intronic
998332920 5:141345442-141345464 CTGGGCTGTCACTGAGAAGATGG - Exonic
998340623 5:141414596-141414618 CAGCGCTGTCACTGAGAAGATGG - Exonic
999117056 5:149173497-149173519 CAGGGCTGCATCTGTCAAGATGG + Intronic
1000048826 5:157544537-157544559 CGTGGCTGCCTCTGTGAAGATGG + Intronic
1002594181 5:180311622-180311644 CAGAGCTGCCACTGGACAGCTGG - Intronic
1003130874 6:3394414-3394436 CAGTTTTGCCACTGAAAAGATGG - Intronic
1004490424 6:16109937-16109959 GAGGCCTGCCACTTTAAACAGGG + Intergenic
1007503026 6:42313076-42313098 CAGGGCTGGCTGTGTAGAGAGGG + Intronic
1007971488 6:46056363-46056385 CAGGGCTGCCTCTGCAAGGAGGG - Intronic
1012903022 6:105029842-105029864 CAGGGCAGCAAATGTAATGATGG + Intronic
1016044394 6:139466378-139466400 CAGGGCTGGCCTTGTAAACAAGG + Intergenic
1017115588 6:150973487-150973509 CAGGGCGGGCACTGGAAAGTTGG + Intronic
1017744390 6:157433866-157433888 CAGTGCTCCCTCTGGAAAGATGG - Intronic
1018659731 6:166074768-166074790 CATGGCTGCCTCTGGAAGGAAGG + Intergenic
1019140279 6:169938332-169938354 CAGGGCTGGCCCTGGACAGAGGG - Intergenic
1019603273 7:1895866-1895888 CAGGCCTGCCACTGGAAAGAAGG + Intronic
1019652250 7:2166322-2166344 GAGGGCAGCAACTGTAAAGCCGG - Intronic
1020830730 7:13091681-13091703 CAGGGCTGCCTCTGGACATAGGG - Intergenic
1021761484 7:23906344-23906366 GAGGGCTGCCACTGACAAGTAGG + Intergenic
1022969724 7:35505848-35505870 CAGGGCTGCCCCTGAGAAGCTGG + Intergenic
1025026781 7:55522779-55522801 AAGGGCTGGCACTGGAAATAAGG + Intronic
1027815478 7:82964423-82964445 CAGGTCTGACACTCAAAAGAGGG + Intronic
1029575995 7:101403681-101403703 GAGGACTGCCATTGAAAAGATGG - Intronic
1031113646 7:117642826-117642848 CAAGGCTCCCACTGTAAATTTGG - Intronic
1033606594 7:142932307-142932329 CAGGGGTCCCACTCTAAAGCAGG + Intronic
1034531317 7:151697834-151697856 CAAGGCTGCCAGGATAAAGAAGG + Intronic
1034689918 7:153006183-153006205 AAGGGCTGAAACTGAAAAGAAGG + Intergenic
1035185550 7:157123194-157123216 GATGGCTGCCATTGAAAAGATGG - Intergenic
1035248721 7:157582472-157582494 GATGGCTGCCACCGAAAAGAGGG + Intronic
1035631639 8:1111139-1111161 CAGGGCTGGAAATGCAAAGATGG + Intergenic
1035645194 8:1213773-1213795 CATGGGAGCCACTGGAAAGATGG - Intergenic
1037685553 8:21136705-21136727 CAGGGCTGCCATAGTGAAGTGGG + Intergenic
1039894536 8:41707145-41707167 CAGTGCTGGCACGGTCAAGAGGG + Intronic
1040538112 8:48327180-48327202 CAGGGCAGGCCCTGGAAAGAGGG + Intergenic
1043627846 8:82286105-82286127 CAGGCCTGCTACACTAAAGATGG + Intergenic
1048818945 8:138361805-138361827 CAGAGCTGTCACTTTAAGGATGG - Intronic
1049716703 8:144096285-144096307 CAGGGCTCCCACTGTTGAGATGG + Intronic
1050098072 9:2088116-2088138 TAAGGCTGCCACTTTAAATAGGG + Intronic
1053346398 9:37381634-37381656 CAGGGCTGCCCCTAGAAACAAGG + Intergenic
1054752111 9:68917785-68917807 GTGGGCTGCCACAGTCAAGAGGG - Intronic
1057147370 9:92767443-92767465 GAGAGCTCCCAGTGTAAAGAAGG + Intergenic
1058312485 9:103521480-103521502 CAAGGCTGCCTCCGAAAAGAGGG + Intergenic
1058600687 9:106666712-106666734 CATTGCTTCCATTGTAAAGATGG - Intergenic
1060003698 9:119981172-119981194 CCAGGCTGACACTGTAAGGAGGG - Intergenic
1060599303 9:124867498-124867520 CAGGGCTGACAGTGTTGAGAGGG - Intronic
1061134849 9:128727908-128727930 CAAGGTTGCCACAGTAAAGGAGG - Intergenic
1189494123 X:41493832-41493854 CAGGGCAGCCAATGGCAAGATGG + Intergenic