ID: 1145243524

View in Genome Browser
Species Human (GRCh38)
Location 17:21253052-21253074
Sequence GAGCCGGGCCGCGGGCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 1, 2: 8, 3: 57, 4: 486}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145243508_1145243524 19 Left 1145243508 17:21253010-21253032 CCGCGGCGCGCGCTTGCAACAGC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243506_1145243524 21 Left 1145243506 17:21253008-21253030 CCCCGCGGCGCGCGCTTGCAACA 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243515_1145243524 -3 Left 1145243515 17:21253032-21253054 CCTTCCCGGGCGGCGGGCCGGAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243516_1145243524 -7 Left 1145243516 17:21253036-21253058 CCCGGGCGGCGGGCCGGAGCCGG 0: 1
1: 0
2: 5
3: 40
4: 401
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243505_1145243524 24 Left 1145243505 17:21253005-21253027 CCACCCCGCGGCGCGCGCTTGCA 0: 1
1: 0
2: 1
3: 10
4: 74
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243507_1145243524 20 Left 1145243507 17:21253009-21253031 CCCGCGGCGCGCGCTTGCAACAG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243518_1145243524 -8 Left 1145243518 17:21253037-21253059 CCGGGCGGCGGGCCGGAGCCGGG 0: 1
1: 0
2: 7
3: 45
4: 426
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486
1145243504_1145243524 30 Left 1145243504 17:21252999-21253021 CCGGGACCACCCCGCGGCGCGCG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1145243524 17:21253052-21253074 GAGCCGGGCCGCGGGCGCGCGGG 0: 1
1: 1
2: 8
3: 57
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145243524 Original CRISPR GAGCCGGGCCGCGGGCGCGC GGG Intronic