ID: 1145243650

View in Genome Browser
Species Human (GRCh38)
Location 17:21253533-21253555
Sequence ACCTCTTAAAGGGGCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 4, 3: 4, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145243645_1145243650 3 Left 1145243645 17:21253507-21253529 CCTTTTTGTTTTGATACATTCCA 0: 1
1: 0
2: 1
3: 58
4: 509
Right 1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG 0: 1
1: 0
2: 4
3: 4
4: 34
1145243644_1145243650 18 Left 1145243644 17:21253492-21253514 CCAGTGGACGCGCGGCCTTTTTG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG 0: 1
1: 0
2: 4
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145243650 Original CRISPR ACCTCTTAAAGGGGCCGCGC CGG Intergenic
902501381 1:16913953-16913975 AGCGCTTACAGGGGCCGCCCTGG - Intronic
905919041 1:41707138-41707160 ACCCCTTCAAGGGGCAGCCCCGG - Intronic
907329430 1:53661544-53661566 ATCTCTTAAAGGGGAGGCGTGGG + Intronic
911638828 1:100266130-100266152 TCGGCTTAAAGGAGCCGCGCTGG - Intergenic
1069279054 10:66630517-66630539 AACTCTTAAAGGGCCCAAGCTGG + Intronic
1069559839 10:69421734-69421756 ACCTTCTAAAGGGGCCGGCCTGG - Intergenic
1072881867 10:99236112-99236134 ATCTCTTAAAGGGGCGGTGCCGG - Intergenic
1080727534 11:34913489-34913511 AGCTCTTAAAGGTGGCACGCAGG + Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1114591542 14:23869485-23869507 ACCTCTCAAAGGGGCAGAGAAGG + Intergenic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG + Intergenic
1136353351 16:29726933-29726955 ATCTCTTAAAAAGGCCGGGCAGG - Intergenic
1140216169 16:73010633-73010655 ACCTCATAAAAGGACCGAGCTGG + Intronic
1143876729 17:9997224-9997246 ATATTTTAAAGGGGCCGGGCGGG + Intronic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1147989673 17:44324956-44324978 CCCCCTTGACGGGGCCGCGCGGG + Intergenic
1157335232 18:46732989-46733011 ACCTCAGAAAGGGGCAGCTCGGG + Intronic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1166682239 19:44776296-44776318 ACCTCTTTAGGAGGCCGAGCAGG + Intergenic
1168669224 19:58228685-58228707 CCCCCTTAAACGGGCCACGCTGG - Intronic
925121578 2:1422346-1422368 ACCTCGTGCAGGCGCCGCGCTGG + Intronic
925121583 2:1422373-1422395 ACCTCGTGCAGGCGCCGCGCTGG + Intronic
926689332 2:15722330-15722352 ACCTCTAAAAGTTGCCGCGCGGG - Intronic
933968507 2:87450852-87450874 ACCTCTTAAAGCTGCAGGGCAGG + Intergenic
934052027 2:88219200-88219222 GCCTCTTAGAGGGGCCGCAGGGG + Intergenic
936325285 2:111499652-111499674 ACCTCTTAAAGCTGCAGGGCAGG - Intergenic
948166882 2:235869894-235869916 ACCTCTTAACAAGGCTGCGCAGG + Intronic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1179411647 21:41167723-41167745 AACCCTTAAAGGGGCAGCGAGGG - Intergenic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
953860835 3:46542940-46542962 ACCTCTTGCAGGGGCCAGGCAGG + Intronic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
956179200 3:66501341-66501363 GCCTCTTAAAGGAGACACGCAGG + Intergenic
956631768 3:71323629-71323651 ACCTCGTAAAAAGGCCCCGCAGG + Intronic
959548914 3:107631282-107631304 ACCTCATAAAGTGCCCGGGCAGG + Intronic
968087760 3:195881591-195881613 TCCTCTTCAAGGGGCATCGCTGG - Intronic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
1004361464 6:14974943-14974965 ACCTCTTACAGGGGCTGTGTTGG - Intergenic
1018400819 6:163416829-163416851 ACCCCTTAAAGGGACAGCTCAGG - Intronic
1025117914 7:56274252-56274274 ACCTGTTAAAGGTGCCCAGCAGG - Intergenic
1034433020 7:151050356-151050378 ACCTGTGAAAGGGGCTGGGCTGG + Intronic
1043307230 8:78810278-78810300 ACCTCTTGAAGGAGCTGCCCGGG + Intergenic